Incidental Mutation 'R7479:Sfxn4'
ID579707
Institutional Source Beutler Lab
Gene Symbol Sfxn4
Ensembl Gene ENSMUSG00000063698
Gene Namesideroflexin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7479 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location60837277-60861479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 60858674 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 57 (D57V)
Ref Sequence ENSEMBL: ENSMUSP00000118743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080806] [ENSMUST00000124921] [ENSMUST00000135808]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080806
AA Change: D57V

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000124921
AA Change: D57V

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000135808
AA Change: D57V

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118743
Gene: ENSMUSG00000063698
AA Change: D57V

DomainStartEndE-ValueType
Pfam:Mtc 11 313 2.1e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sideroflexin family. The encoded protein is a transmembrane protein of the inner mitochondrial membrane, and is required for mitochondrial respiratory homeostasis and erythropoiesis. Mutations in this gene are associated with mitochondriopathy and macrocytic anemia. Alternatively spliced transcript variants have been found in this gene. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,578,493 M81L probably benign Het
Ano9 T C 7: 141,102,435 T667A probably damaging Het
Anpep T A 7: 79,835,370 I623F probably benign Het
Apba2 T C 7: 64,739,859 I501T possibly damaging Het
Ascc3 T A 10: 50,649,799 Y536N probably damaging Het
B4galt1 T C 4: 40,823,587 Y168C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C2 A G 17: 34,863,465 C647R probably damaging Het
Cnot4 G A 6: 35,024,148 T604I probably benign Het
Col11a1 C T 3: 114,102,569 T506I unknown Het
Cr2 A C 1: 195,158,410 probably null Het
Ctsm A T 13: 61,537,755 V281D probably damaging Het
Cyp2c69 T C 19: 39,881,557 I74V probably benign Het
Dennd4c T A 4: 86,799,353 V529D probably damaging Het
Dlgap3 C A 4: 127,194,625 H5N possibly damaging Het
Dusp10 C A 1: 184,037,420 H194Q probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eln C G 5: 134,707,575 G753A unknown Het
Emb T A 13: 117,249,426 N118K possibly damaging Het
Fam184a C T 10: 53,655,014 V755I probably benign Het
Fryl A G 5: 73,097,561 I846T possibly damaging Het
Gabbr2 T A 4: 46,681,166 I722F probably damaging Het
Gabrb3 T A 7: 57,824,423 D362E possibly damaging Het
Galnt2 G A 8: 124,334,338 G357D probably damaging Het
Gbx2 A T 1: 89,930,651 S35R probably benign Het
Glg1 A G 8: 111,197,735 I207T possibly damaging Het
Gm10192 A T 4: 97,183,035 N44K unknown Het
Gpd1 A G 15: 99,720,103 D123G probably benign Het
Grm2 A T 9: 106,653,851 D146E possibly damaging Het
Gsg1l2 A G 11: 67,785,206 D132G probably benign Het
Hecw1 C T 13: 14,340,840 G236R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hspg2 C T 4: 137,539,403 A1934V probably benign Het
Il7r C T 15: 9,513,031 A131T probably damaging Het
Itga6 C T 2: 71,838,336 R540* probably null Het
Kcnh2 A G 5: 24,325,492 probably null Het
Kcnq4 C T 4: 120,715,825 A260T probably damaging Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrrc41 C T 4: 116,089,041 P318S probably damaging Het
Map4 G A 9: 110,068,824 G873R possibly damaging Het
Med24 A G 11: 98,704,961 I968T possibly damaging Het
Mfap5 T C 6: 122,526,862 probably null Het
Mtcl1 A G 17: 66,379,490 V807A probably benign Het
Mug1 T A 6: 121,878,508 S934T possibly damaging Het
Nckap5l C A 15: 99,423,246 V1218F probably damaging Het
Nek1 T A 8: 61,130,145 D1272E probably benign Het
Nkx2-4 T C 2: 147,084,168 E258G probably benign Het
Polr1a T A 6: 71,936,297 V545E probably damaging Het
Ppp1r9b A G 11: 94,992,032 D162G possibly damaging Het
Rhot2 A G 17: 25,840,749 L367P probably damaging Het
Ripk2 A G 4: 16,155,154 F122L probably benign Het
Scn11a T C 9: 119,759,875 T1322A probably benign Het
Scn8a T A 15: 100,955,477 L115Q probably damaging Het
Sel1l3 G T 5: 53,117,120 P1006Q probably damaging Het
Sept11 A T 5: 93,156,945 N207I probably damaging Het
Sez6l2 C T 7: 126,963,659 T669I probably damaging Het
Smarca2 T A 19: 26,640,487 V306D probably benign Het
Srgap3 C T 6: 112,735,833 probably null Het
Tas2r134 T C 2: 51,627,529 F7L not run Het
Tbcd T C 11: 121,492,605 probably null Het
Tcn2 G A 11: 3,917,703 A413V probably damaging Het
Tdp1 T C 12: 99,891,395 V71A probably benign Het
Tjp1 T C 7: 65,301,180 T1649A probably damaging Het
Tnc T C 4: 64,017,628 E357G possibly damaging Het
Tnrc6b A G 15: 80,889,126 T1158A probably benign Het
Ttn C A 2: 76,738,608 E27314* probably null Het
Vps35 G T 8: 85,270,805 T512K probably benign Het
Zfp40 A T 17: 23,177,318 S98R probably benign Het
Zfp945 A T 17: 22,851,366 C541S possibly damaging Het
Zfp976 T A 7: 42,613,179 E412D probably benign Het
Other mutations in Sfxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Sfxn4 APN 19 60851014 missense possibly damaging 0.91
IGL01567:Sfxn4 APN 19 60853898 missense probably damaging 1.00
IGL01829:Sfxn4 APN 19 60858734 missense probably damaging 1.00
IGL01903:Sfxn4 APN 19 60858680 missense probably damaging 0.99
IGL01965:Sfxn4 APN 19 60858744 splice site probably benign
IGL03290:Sfxn4 APN 19 60860070 missense probably damaging 1.00
R0346:Sfxn4 UTSW 19 60858673 missense probably benign 0.01
R0550:Sfxn4 UTSW 19 60850945 splice site probably benign
R2228:Sfxn4 UTSW 19 60851020 missense probably damaging 1.00
R2229:Sfxn4 UTSW 19 60851020 missense probably damaging 1.00
R3949:Sfxn4 UTSW 19 60852063 missense probably damaging 1.00
R5074:Sfxn4 UTSW 19 60851012 missense probably damaging 1.00
R6534:Sfxn4 UTSW 19 60839023 missense probably damaging 1.00
R7120:Sfxn4 UTSW 19 60852039 nonsense probably null
R7375:Sfxn4 UTSW 19 60858674 missense probably benign 0.38
R7438:Sfxn4 UTSW 19 60857361 missense probably damaging 0.99
R7440:Sfxn4 UTSW 19 60842204 missense possibly damaging 0.92
R7577:Sfxn4 UTSW 19 60853886 missense probably benign 0.21
R7883:Sfxn4 UTSW 19 60858749 splice site probably null
R8058:Sfxn4 UTSW 19 60844252 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTCTAGCTGCATTATGAGATAG -3'
(R):5'- GGAACTGAAGTGCTGTGTGC -3'

Sequencing Primer
(F):5'- TGATTCCCCTGGGCAATA -3'
(R):5'- CTGGGATTTGAACTCAGGACC -3'
Posted On2019-10-07