Incidental Mutation 'R7480:Cr2'
ID 579713
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7480 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 194836484 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 893 (C893Y)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082321
AA Change: C893Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: C893Y

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193356
AA Change: C596Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: C596Y

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195120
AA Change: C893Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: C893Y

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: C1269Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 T G 9: 50,733,928 (GRCm39) M542R probably benign Het
Apol10b G T 15: 77,472,988 (GRCm39) A22D probably benign Het
Arhgap45 T A 10: 79,862,936 (GRCm39) L704* probably null Het
Bicc1 T C 10: 70,779,306 (GRCm39) D694G probably damaging Het
C1ql3 A T 2: 13,015,150 (GRCm39) I170N probably damaging Het
Casz1 T C 4: 149,029,043 (GRCm39) F1163L probably damaging Het
Ces2f A G 8: 105,681,338 (GRCm39) K559R possibly damaging Het
Col19a1 C T 1: 24,356,788 (GRCm39) G632R probably damaging Het
Csf1r T G 18: 61,250,610 (GRCm39) D440E probably benign Het
Cul9 A T 17: 46,848,738 (GRCm39) M666K probably benign Het
Dapk1 A G 13: 60,905,311 (GRCm39) D1007G probably benign Het
Dlk1 T A 12: 109,421,540 (GRCm39) C85S probably damaging Het
Epb41l3 A C 17: 69,568,867 (GRCm39) probably null Het
Eri2 T A 7: 119,385,734 (GRCm39) R256* probably null Het
Fshr A C 17: 89,292,802 (GRCm39) Y625* probably null Het
Galk2 A G 2: 125,788,845 (GRCm39) I300V probably benign Het
Garin1a G A 6: 29,281,435 (GRCm39) probably null Het
Gm3409 T A 5: 146,476,311 (GRCm39) V154E probably damaging Het
Gm7356 A G 17: 14,221,327 (GRCm39) I234T possibly damaging Het
Gtf3c1 T C 7: 125,241,713 (GRCm39) Y1995C probably benign Het
Herc6 C T 6: 57,558,206 (GRCm39) T62I possibly damaging Het
Hif3a G A 7: 16,776,560 (GRCm39) T462I possibly damaging Het
Hmcn1 A T 1: 150,552,985 (GRCm39) probably null Het
Iqca1l T G 5: 24,751,904 (GRCm39) E498A probably damaging Het
Jrk G T 15: 74,578,902 (GRCm39) P128T probably benign Het
Kctd14 T C 7: 97,107,431 (GRCm39) F229L probably benign Het
Kif27 A T 13: 58,436,025 (GRCm39) V1256E probably benign Het
Klk13 T C 7: 43,370,846 (GRCm39) S133P probably benign Het
Mpzl1 A G 1: 165,432,257 (GRCm39) V176A possibly damaging Het
Mxi1 A G 19: 53,360,066 (GRCm39) T263A possibly damaging Het
Nfxl1 C T 5: 72,716,595 (GRCm39) W5* probably null Het
Nt5dc1 C T 10: 34,200,450 (GRCm39) G190R probably damaging Het
Nt5dc1 C A 10: 34,200,449 (GRCm39) G190V probably damaging Het
Oprd1 A G 4: 131,844,492 (GRCm39) I172T possibly damaging Het
Or1f19 A T 16: 3,410,493 (GRCm39) T78S probably benign Het
Or4k38 A G 2: 111,165,737 (GRCm39) S229P probably benign Het
Or6f1 A G 7: 85,970,888 (GRCm39) S91P probably benign Het
Or7e173 C T 9: 19,939,230 (GRCm39) M1I probably null Het
Pafah1b1 A C 11: 74,576,740 (GRCm39) C184G probably damaging Het
Pde5a A T 3: 122,596,797 (GRCm39) N495Y possibly damaging Het
Piezo1 A T 8: 123,225,234 (GRCm39) Y588* probably null Het
Plekha7 A T 7: 115,736,403 (GRCm39) probably null Het
Pramel11 T C 4: 143,622,065 (GRCm39) D430G probably benign Het
Prdm11 T C 2: 92,805,669 (GRCm39) K427R probably benign Het
Rai14 C A 15: 10,571,622 (GRCm39) E940D probably benign Het
Rasl11b T A 5: 74,358,771 (GRCm39) V92E possibly damaging Het
Rassf8 T A 6: 145,765,757 (GRCm39) I29K unknown Het
Reg3a C T 6: 78,359,330 (GRCm39) T110I probably damaging Het
Scaf1 C T 7: 44,657,073 (GRCm39) G602D unknown Het
Senp6 T C 9: 80,029,199 (GRCm39) C521R probably damaging Het
Senp7 G A 16: 55,975,589 (GRCm39) V432I possibly damaging Het
Skint8 A T 4: 111,785,784 (GRCm39) R77* probably null Het
Slamf9 G A 1: 172,305,040 (GRCm39) C218Y probably damaging Het
Slc8a1 T C 17: 81,956,649 (GRCm39) T130A probably damaging Het
Smpdl3a A G 10: 57,678,574 (GRCm39) I126V possibly damaging Het
Taar9 T A 10: 23,984,843 (GRCm39) N197I possibly damaging Het
Tango6 A T 8: 107,423,359 (GRCm39) D378V possibly damaging Het
Tfb2m A G 1: 179,356,747 (GRCm39) F396L probably benign Het
Thbs4 G A 13: 92,903,729 (GRCm39) P429L probably benign Het
Tnxb A G 17: 34,934,747 (GRCm39) D2452G probably damaging Het
Ulk3 C T 9: 57,498,523 (GRCm39) R131* probably null Het
Vmn1r179 A T 7: 23,628,558 (GRCm39) R250* probably null Het
Vmn1r54 A G 6: 90,246,160 (GRCm39) I25V possibly damaging Het
Wnt7a C A 6: 91,371,395 (GRCm39) R189L probably benign Het
Wrap73 A G 4: 154,237,043 (GRCm39) D210G probably benign Het
Xpo6 G A 7: 125,701,505 (GRCm39) R1112* probably null Het
Zfp114 T A 7: 23,881,307 (GRCm39) V552D probably damaging Het
Zfp764l1 C T 7: 126,992,496 (GRCm39) C38Y probably null Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TAGGGATGTTTGTCAAATGCACTC -3'
(R):5'- ACATGTGTTACTCTGTGCCC -3'

Sequencing Primer
(F):5'- CAATAGGGTCACTATAGCAAT -3'
(R):5'- GTGTTACTCTGTGCCCAATTAAAAG -3'
Posted On 2019-10-07