Incidental Mutation 'R7480:4931409K22Rik'
ID579724
Institutional Source Beutler Lab
Gene Symbol 4931409K22Rik
Ensembl Gene ENSMUSG00000038199
Gene NameRIKEN cDNA 4931409K22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location24543432-24556809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24546906 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 498 (E498A)
Ref Sequence ENSEMBL: ENSMUSP00000085642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088302] [ENSMUST00000200634]
Predicted Effect probably damaging
Transcript: ENSMUST00000088302
AA Change: E498A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085642
Gene: ENSMUSG00000038199
AA Change: E498A

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
IQ 205 227 7.58e-2 SMART
coiled coil region 335 382 N/A INTRINSIC
coiled coil region 429 450 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Pfam:AAA 568 700 1.6e-14 PFAM
low complexity region 819 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200634
SMART Domains Protein: ENSMUSP00000142624
Gene: ENSMUSG00000038199

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 70 77 N/A INTRINSIC
low complexity region 184 198 N/A INTRINSIC
Meta Mutation Damage Score 0.1307 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in 4931409K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:4931409K22Rik APN 5 24548294 missense probably benign 0.03
IGL02110:4931409K22Rik APN 5 24548084 splice site probably benign
R0329:4931409K22Rik UTSW 5 24545785 splice site probably null
R0492:4931409K22Rik UTSW 5 24554628 missense probably damaging 1.00
R0585:4931409K22Rik UTSW 5 24550723 missense probably benign
R0656:4931409K22Rik UTSW 5 24549762 missense possibly damaging 0.67
R0894:4931409K22Rik UTSW 5 24550733 splice site probably null
R1546:4931409K22Rik UTSW 5 24555428 splice site probably null
R1642:4931409K22Rik UTSW 5 24552688 missense probably damaging 1.00
R1998:4931409K22Rik UTSW 5 24545006 missense probably benign 0.01
R2090:4931409K22Rik UTSW 5 24550676 missense probably benign 0.15
R2186:4931409K22Rik UTSW 5 24554526 missense probably damaging 1.00
R2237:4931409K22Rik UTSW 5 24548294 missense probably benign 0.03
R2256:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R2257:4931409K22Rik UTSW 5 24552040 utr 3 prime probably benign
R3078:4931409K22Rik UTSW 5 24546666 missense probably benign
R3522:4931409K22Rik UTSW 5 24549626 critical splice donor site probably null
R3910:4931409K22Rik UTSW 5 24545442 splice site probably benign
R3911:4931409K22Rik UTSW 5 24545442 splice site probably benign
R4333:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4335:4931409K22Rik UTSW 5 24544370 missense probably damaging 1.00
R4500:4931409K22Rik UTSW 5 24548277 missense possibly damaging 0.85
R4761:4931409K22Rik UTSW 5 24551983 missense probably benign
R4773:4931409K22Rik UTSW 5 24550598 critical splice donor site probably null
R4880:4931409K22Rik UTSW 5 24549752 missense probably benign
R5614:4931409K22Rik UTSW 5 24550142 missense probably benign 0.03
R5839:4931409K22Rik UTSW 5 24552026 missense probably damaging 0.98
R5847:4931409K22Rik UTSW 5 24544166 missense probably benign 0.16
R7061:4931409K22Rik UTSW 5 24545065 missense probably benign 0.00
R7131:4931409K22Rik UTSW 5 24548956 missense possibly damaging 0.81
R7156:4931409K22Rik UTSW 5 24552650 missense probably benign 0.05
R7248:4931409K22Rik UTSW 5 24544271 missense probably benign 0.00
R7693:4931409K22Rik UTSW 5 24546628 missense probably benign 0.01
R7782:4931409K22Rik UTSW 5 24544226 missense probably damaging 0.98
R7814:4931409K22Rik UTSW 5 24545422 missense possibly damaging 0.95
R7898:4931409K22Rik UTSW 5 24553645 missense probably damaging 1.00
R8024:4931409K22Rik UTSW 5 24550636 missense possibly damaging 0.70
R8172:4931409K22Rik UTSW 5 24543610 missense probably benign
R8281:4931409K22Rik UTSW 5 24549010 missense probably benign 0.02
R8511:4931409K22Rik UTSW 5 24545908 missense possibly damaging 0.95
R8888:4931409K22Rik UTSW 5 24550630 missense probably benign 0.20
R8895:4931409K22Rik UTSW 5 24550630 missense probably benign 0.20
X0063:4931409K22Rik UTSW 5 24549765 splice site probably null
Z1177:4931409K22Rik UTSW 5 24550795 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAACTGGTGAGTGACCCTC -3'
(R):5'- TATGCCCTGACACAGTGGAC -3'

Sequencing Primer
(F):5'- CCTCCTGGGAGTGTCTGTGAG -3'
(R):5'- ACAGTGGACAGGACCTCATTTTCTG -3'
Posted On2019-10-07