Incidental Mutation 'R0631:Stxbp5'
ID 57974
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Name syntaxin binding protein 5 (tomosyn)
Synonyms LGL3, tomosyn 1, 0710001E20Rik, 4930565N16Rik
MMRRC Submission 038820-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0631 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 9631291-9776823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9660102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 731 (N731I)
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]
AlphaFold Q8K400
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: N731I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: N731I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125200
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136259
Predicted Effect probably benign
Transcript: ENSMUST00000136324
SMART Domains Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139779
Predicted Effect probably benign
Transcript: ENSMUST00000141722
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,982,479 (GRCm39) probably benign Het
Afap1l2 T C 19: 56,904,517 (GRCm39) E594G probably benign Het
Ak8 T G 2: 28,625,677 (GRCm39) I240S probably damaging Het
Akap13 T C 7: 75,264,744 (GRCm39) V174A probably damaging Het
Alppl2 G A 1: 87,017,095 (GRCm39) T66I probably damaging Het
Ankrd61 T A 5: 143,831,697 (GRCm39) I36F probably damaging Het
Antxrl T A 14: 33,780,758 (GRCm39) probably null Het
Arhgef2 G C 3: 88,541,743 (GRCm39) V244L probably damaging Het
Arid1a A G 4: 133,416,481 (GRCm39) I1098T unknown Het
Atr T C 9: 95,756,830 (GRCm39) V903A possibly damaging Het
B3gnt6 C A 7: 97,842,899 (GRCm39) A354S probably benign Het
Bnc1 A T 7: 81,624,114 (GRCm39) I371N probably damaging Het
Camsap1 A T 2: 25,823,659 (GRCm39) S1464T probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Cass4 T C 2: 172,274,331 (GRCm39) I728T probably damaging Het
Ccdc88a A T 11: 29,443,752 (GRCm39) M1378L probably damaging Het
Ccdc9 C A 7: 16,012,384 (GRCm39) W266L probably damaging Het
Cct6b C A 11: 82,627,914 (GRCm39) probably null Het
Cd177 T C 7: 24,456,111 (GRCm39) E219G probably benign Het
Cdkal1 A T 13: 29,538,667 (GRCm39) Y497* probably null Het
Chmp2a T C 7: 12,766,371 (GRCm39) E107G probably damaging Het
Chrna2 T G 14: 66,386,757 (GRCm39) V301G probably benign Het
Chrna7 A G 7: 62,749,391 (GRCm39) C364R probably benign Het
Cltc G T 11: 86,603,439 (GRCm39) L796I probably benign Het
Col12a1 T C 9: 79,610,658 (GRCm39) T249A probably damaging Het
Col13a1 G A 10: 61,723,129 (GRCm39) Q270* probably null Het
Col6a1 C T 10: 76,545,569 (GRCm39) V968M probably benign Het
Copb1 C A 7: 113,832,517 (GRCm39) V511F probably benign Het
Daw1 C G 1: 83,174,981 (GRCm39) S160R probably damaging Het
Ddx46 A G 13: 55,787,590 (GRCm39) probably benign Het
Depdc7 T C 2: 104,552,332 (GRCm39) K492E possibly damaging Het
Dmbt1 C T 7: 130,699,383 (GRCm39) A1004V possibly damaging Het
Dnah7b G A 1: 46,280,152 (GRCm39) V2694I probably benign Het
Dnhd1 T A 7: 105,300,831 (GRCm39) F63I probably benign Het
Edc4 C A 8: 106,617,424 (GRCm39) A1052E possibly damaging Het
Eif2s2 T A 2: 154,726,278 (GRCm39) K129M probably damaging Het
Emx2 A G 19: 59,452,460 (GRCm39) D248G probably damaging Het
Erich6b T C 14: 75,896,449 (GRCm39) probably benign Het
Exoc3l4 A G 12: 111,394,400 (GRCm39) K507E probably benign Het
Fanci T A 7: 79,055,953 (GRCm39) V195E probably damaging Het
Fgfr2 T G 7: 129,828,969 (GRCm39) probably benign Het
Frem1 A G 4: 82,890,402 (GRCm39) S1007P probably damaging Het
Fry T C 5: 150,419,817 (GRCm39) I993T possibly damaging Het
Fst A G 13: 114,591,038 (GRCm39) S244P possibly damaging Het
Gcc1 T C 6: 28,421,009 (GRCm39) T103A probably damaging Het
Gdf2 C T 14: 33,663,178 (GRCm39) P24L probably damaging Het
Gja3 T C 14: 57,274,219 (GRCm39) D51G possibly damaging Het
Gm10305 A G 4: 99,161,313 (GRCm39) D74G unknown Het
Gm12689 G T 4: 99,184,258 (GRCm39) G37V unknown Het
Gm5424 C T 10: 61,907,313 (GRCm39) noncoding transcript Het
Hephl1 T C 9: 14,995,820 (GRCm39) E434G probably benign Het
Hoatz T A 9: 51,013,253 (GRCm39) R6S probably benign Het
Htatip2 T C 7: 49,423,059 (GRCm39) C205R possibly damaging Het
Igf2r T C 17: 12,936,161 (GRCm39) probably null Het
Ints2 T C 11: 86,124,022 (GRCm39) I589V probably benign Het
Itgae T A 11: 73,005,733 (GRCm39) V299D probably damaging Het
Kcnma1 T C 14: 23,559,852 (GRCm39) probably benign Het
Kif11 A G 19: 37,401,565 (GRCm39) probably benign Het
Kif13a A G 13: 46,932,364 (GRCm39) probably benign Het
Kif18a T A 2: 109,128,667 (GRCm39) probably benign Het
Klhl29 T C 12: 5,144,883 (GRCm39) T406A probably benign Het
Litaf A T 16: 10,784,276 (GRCm39) probably benign Het
Lmntd1 T A 6: 145,375,726 (GRCm39) I71F probably benign Het
Lrit3 A C 3: 129,582,204 (GRCm39) C594W probably damaging Het
Lrp6 T A 6: 134,456,738 (GRCm39) Q842L possibly damaging Het
Lrrcc1 T A 3: 14,605,179 (GRCm39) probably benign Het
Macf1 A T 4: 123,349,317 (GRCm39) L1829* probably null Het
Mapk1ip1 T C 7: 138,437,684 (GRCm39) T249A possibly damaging Het
Mfap4 T C 11: 61,378,006 (GRCm39) F173L probably damaging Het
Mfsd9 C A 1: 40,829,634 (GRCm39) probably benign Het
Mgat4b T C 11: 50,121,590 (GRCm39) S69P probably damaging Het
Mki67 A T 7: 135,306,117 (GRCm39) V620D probably damaging Het
Moxd1 C T 10: 24,128,852 (GRCm39) T201I probably damaging Het
Msh4 G C 3: 153,572,057 (GRCm39) D774E probably benign Het
Myg1 C T 15: 102,240,284 (GRCm39) R37C probably benign Het
Myrf C A 19: 10,206,246 (GRCm39) A57S probably benign Het
Ndst1 G A 18: 60,833,431 (GRCm39) probably benign Het
Nedd4l A T 18: 65,341,574 (GRCm39) probably benign Het
Neil2 T A 14: 63,420,849 (GRCm39) I281F possibly damaging Het
Nfatc2 T A 2: 168,432,035 (GRCm39) D26V probably benign Het
Nt5c A G 11: 115,381,540 (GRCm39) probably null Het
Or13a24 T G 7: 140,154,420 (GRCm39) M118R probably damaging Het
Or2w1b G T 13: 21,300,078 (GRCm39) C72F probably damaging Het
Or2z8 T A 8: 72,812,166 (GRCm39) I214N probably damaging Het
Or5ac20 A G 16: 59,104,570 (GRCm39) C97R possibly damaging Het
Or5t15 T C 2: 86,681,311 (GRCm39) T244A probably benign Het
Ovch2 A G 7: 107,381,228 (GRCm39) S557P probably benign Het
Pik3cg A G 12: 32,255,202 (GRCm39) S262P probably benign Het
Pla2g6 T A 15: 79,190,596 (GRCm39) H322L probably damaging Het
Plch1 A T 3: 63,606,640 (GRCm39) L1079Q probably benign Het
Plekhg4 T A 8: 106,105,934 (GRCm39) V777D probably damaging Het
Plekhg5 A G 4: 152,196,876 (GRCm39) D747G possibly damaging Het
Poln C A 5: 34,276,302 (GRCm39) V318F possibly damaging Het
Pou5f2 T A 13: 78,173,873 (GRCm39) S272T probably benign Het
Ppp1r3e T G 14: 55,114,073 (GRCm39) S200R possibly damaging Het
Prl7d1 G A 13: 27,894,165 (GRCm39) P135S probably benign Het
Ptgs2 G A 1: 149,980,288 (GRCm39) V409I probably benign Het
Ptk2b T C 14: 66,415,200 (GRCm39) T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 (GRCm39) T747A probably damaging Het
Qrfpr A G 3: 36,276,138 (GRCm39) I84T probably damaging Het
Rab44 A G 17: 29,358,118 (GRCm39) D102G possibly damaging Het
Rimoc1 A G 15: 4,015,971 (GRCm39) probably benign Het
Rnf125 A T 18: 21,112,140 (GRCm39) D57V possibly damaging Het
Rnf145 T C 11: 44,450,851 (GRCm39) F392L probably damaging Het
Rttn A G 18: 89,007,670 (GRCm39) N435S probably benign Het
Scn8a A G 15: 100,933,418 (GRCm39) T1500A probably damaging Het
Sgsm1 A G 5: 113,432,989 (GRCm39) probably benign Het
Sgsm3 A T 15: 80,895,937 (GRCm39) *751C probably null Het
Slc35c2 A C 2: 165,122,849 (GRCm39) L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 (GRCm38) E396V probably damaging Het
Smarca4 G C 9: 21,570,280 (GRCm39) probably benign Het
Snapc3 T A 4: 83,336,039 (GRCm39) V17D probably damaging Het
Snta1 G T 2: 154,218,992 (GRCm39) Q448K probably benign Het
Sptbn2 A G 19: 4,790,014 (GRCm39) D1334G probably benign Het
Stard5 A G 7: 83,281,965 (GRCm39) R41G probably damaging Het
Tmem135 T A 7: 88,792,996 (GRCm39) K413* probably null Het
Tmem38a G A 8: 73,333,862 (GRCm39) V114I probably benign Het
Tpr A G 1: 150,298,282 (GRCm39) T1057A probably damaging Het
Ttc23l A T 15: 10,540,066 (GRCm39) L139Q probably damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Tuba3b A G 6: 145,565,302 (GRCm39) T257A probably damaging Het
Tubgcp6 A C 15: 88,985,190 (GRCm39) Y1633D probably damaging Het
Txnl1 C T 18: 63,804,644 (GRCm39) probably benign Het
Unc13b A G 4: 43,182,849 (GRCm39) Q3186R possibly damaging Het
Vmn2r75 T A 7: 85,812,478 (GRCm39) S514C probably null Het
Whrn G A 4: 63,337,726 (GRCm39) T545I probably damaging Het
Zdhhc20 T C 14: 58,095,097 (GRCm39) H154R probably damaging Het
Zfp462 A T 4: 55,007,563 (GRCm39) M1L possibly damaging Het
Zfp831 A G 2: 174,487,083 (GRCm39) K586R possibly damaging Het
Zfp990 A T 4: 145,263,872 (GRCm39) H290L possibly damaging Het
Zfpm1 C T 8: 123,063,613 (GRCm39) probably benign Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9,675,694 (GRCm39) missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9,684,346 (GRCm39) splice site probably benign
IGL01725:Stxbp5 APN 10 9,693,155 (GRCm39) missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9,638,565 (GRCm39) missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9,692,041 (GRCm39) missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9,638,700 (GRCm39) nonsense probably null
IGL02720:Stxbp5 APN 10 9,665,105 (GRCm39) critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9,692,034 (GRCm39) missense probably null 1.00
IGL03288:Stxbp5 APN 10 9,742,447 (GRCm39) splice site probably null
Fatty_fish UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
reindeer UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9,645,187 (GRCm39) missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9,693,048 (GRCm39) critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9,646,272 (GRCm39) missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9,742,442 (GRCm39) splice site probably benign
R0723:Stxbp5 UTSW 10 9,644,617 (GRCm39) missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9,684,784 (GRCm39) missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9,688,135 (GRCm39) missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9,692,013 (GRCm39) missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9,711,590 (GRCm39) missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9,644,671 (GRCm39) missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9,645,163 (GRCm39) missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9,665,060 (GRCm39) intron probably benign
R4572:Stxbp5 UTSW 10 9,713,888 (GRCm39) missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9,646,367 (GRCm39) missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9,688,085 (GRCm39) nonsense probably null
R4887:Stxbp5 UTSW 10 9,684,844 (GRCm39) missense probably benign
R4930:Stxbp5 UTSW 10 9,636,610 (GRCm39) utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9,674,019 (GRCm39) critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9,675,735 (GRCm39) missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9,684,252 (GRCm39) missense probably benign
R5531:Stxbp5 UTSW 10 9,638,668 (GRCm39) nonsense probably null
R5605:Stxbp5 UTSW 10 9,645,490 (GRCm39) intron probably benign
R5614:Stxbp5 UTSW 10 9,636,638 (GRCm39) utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9,776,330 (GRCm39) missense probably benign
R5990:Stxbp5 UTSW 10 9,711,677 (GRCm39) missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9,675,772 (GRCm39) missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9,646,430 (GRCm39) missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9,684,216 (GRCm39) missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9,693,083 (GRCm39) missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9,642,931 (GRCm39) missense probably damaging 1.00
R6284:Stxbp5 UTSW 10 9,642,923 (GRCm39) missense probably benign 0.32
R6394:Stxbp5 UTSW 10 9,774,975 (GRCm39) nonsense probably null
R6427:Stxbp5 UTSW 10 9,774,998 (GRCm39) missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9,660,105 (GRCm39) missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9,673,931 (GRCm39) missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9,684,874 (GRCm39) missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9,645,154 (GRCm39) missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9,684,248 (GRCm39) missense probably benign
R7974:Stxbp5 UTSW 10 9,646,439 (GRCm39) splice site probably null
R8009:Stxbp5 UTSW 10 9,692,046 (GRCm39) missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9,660,129 (GRCm39) missense probably benign
R8353:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9,688,003 (GRCm39) critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9,688,033 (GRCm39) missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9,693,050 (GRCm39) missense probably null 0.98
R8805:Stxbp5 UTSW 10 9,713,859 (GRCm39) nonsense probably null
R9172:Stxbp5 UTSW 10 9,645,152 (GRCm39) missense possibly damaging 0.94
R9472:Stxbp5 UTSW 10 9,719,101 (GRCm39) missense probably damaging 1.00
R9513:Stxbp5 UTSW 10 9,687,754 (GRCm39) missense probably benign 0.17
R9649:Stxbp5 UTSW 10 9,774,938 (GRCm39) missense probably damaging 0.96
X0020:Stxbp5 UTSW 10 9,638,634 (GRCm39) missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9,776,289 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCATTGCATGGAGCAACGATTAGA -3'
(R):5'- GGGCTTAAGGGGAAAGTAATCCCCA -3'

Sequencing Primer
(F):5'- TCTATTTCCTACCTAGATCATTGGC -3'
(R):5'- GTAATCCCCAATTTGGAAGGTG -3'
Posted On 2013-07-11