Mutagenetix > Incidental Mutation

Incidental Mutation 'R0631:Stxbp5'

57974

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

038820-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0631 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9784358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 731 (N731I)

Ref Sequence

ENSEMBL: ENSMUSP00000044535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]

AlphaFold

Q8K400

Predicted Effect

probably benign
Transcript: ENSMUST00000038213
AA Change: N731I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: N731I

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000125200

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136259

Predicted Effect

probably benign
Transcript: ENSMUST00000136324

SMART Domains

Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	98	106	N/A	INTRINSIC
low complexity region	209	230	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139779

Predicted Effect

probably benign
Transcript: ENSMUST00000141722

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151435

Meta Mutation Damage Score

0.0668

Coding Region Coverage

1x: 99.4%
3x: 99.1%
10x: 98.1%
20x: 96.8%

Validation Efficiency

97% (129/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 131 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	T	A	9: 51,101,953	R6S	probably benign	Het
Aadat	T	C	8: 60,529,445		probably benign	Het
Afap1l2	T	C	19: 56,916,085	E594G	probably benign	Het
Ak8	T	G	2: 28,735,665	I240S	probably damaging	Het
Akap13	T	C	7: 75,614,996	V174A	probably damaging	Het
Alppl2	G	A	1: 87,089,373	T66I	probably damaging	Het
Ankrd61	T	A	5: 143,894,879	I36F	probably damaging	Het
Antxrl	T	A	14: 34,058,801		probably null	Het
Arhgef2	G	C	3: 88,634,436	V244L	probably damaging	Het
Arid1a	A	G	4: 133,689,170	I1098T	unknown	Het
Atr	T	C	9: 95,874,777	V903A	possibly damaging	Het
AW549877	A	G	15: 3,986,489		probably benign	Het
B3gnt6	C	A	7: 98,193,692	A354S	probably benign	Het
Bnc1	A	T	7: 81,974,366	I371N	probably damaging	Het
Camsap1	A	T	2: 25,933,647	S1464T	probably damaging	Het
Cand2	G	A	6: 115,803,805	E1217K	probably damaging	Het
Cass4	T	C	2: 172,432,411	I728T	probably damaging	Het
Ccdc88a	A	T	11: 29,493,752	M1378L	probably damaging	Het
Ccdc9	C	A	7: 16,278,459	W266L	probably damaging	Het
Cct6b	C	A	11: 82,737,088		probably null	Het
Cd177	T	C	7: 24,756,686	E219G	probably benign	Het
Cdkal1	A	T	13: 29,354,684	Y497*	probably null	Het
Chmp2a	T	C	7: 13,032,444	E107G	probably damaging	Het
Chrna2	T	G	14: 66,149,308	V301G	probably benign	Het
Chrna7	A	G	7: 63,099,643	C364R	probably benign	Het
Cltc	G	T	11: 86,712,613	L796I	probably benign	Het
Col12a1	T	C	9: 79,703,376	T249A	probably damaging	Het
Col13a1	G	A	10: 61,887,350	Q270*	probably null	Het
Col6a1	C	T	10: 76,709,735	V968M	probably benign	Het
Copb1	C	A	7: 114,233,282	V511F	probably benign	Het
Daw1	C	G	1: 83,197,260	S160R	probably damaging	Het
Ddx46	A	G	13: 55,639,777		probably benign	Het
Depdc7	T	C	2: 104,721,987	K492E	possibly damaging	Het
Dmbt1	C	T	7: 131,097,653	A1004V	possibly damaging	Het
Dnah7b	G	A	1: 46,240,992	V2694I	probably benign	Het
Dnhd1	T	A	7: 105,651,624	F63I	probably benign	Het
Edc4	C	A	8: 105,890,792	A1052E	possibly damaging	Het
Eif2s2	T	A	2: 154,884,358	K129M	probably damaging	Het
Emx2	A	G	19: 59,464,028	D248G	probably damaging	Het
Erich6b	T	C	14: 75,659,009		probably benign	Het
Exoc3l4	A	G	12: 111,427,966	K507E	probably benign	Het
Fanci	T	A	7: 79,406,205	V195E	probably damaging	Het
Fgfr2	T	G	7: 130,227,239		probably benign	Het
Frem1	A	G	4: 82,972,165	S1007P	probably damaging	Het
Fry	T	C	5: 150,496,352	I993T	possibly damaging	Het
Fst	A	G	13: 114,454,502	S244P	possibly damaging	Het
Gcc1	T	C	6: 28,421,010	T103A	probably damaging	Het
Gdf2	C	T	14: 33,941,221	P24L	probably damaging	Het
Gja3	T	C	14: 57,036,762	D51G	possibly damaging	Het
Gm10305	A	G	4: 99,273,076	D74G	unknown	Het
Gm12689	G	T	4: 99,296,021	G37V	unknown	Het
Gm5424	C	T	10: 62,071,534		noncoding transcript	Het
Hephl1	T	C	9: 15,084,524	E434G	probably benign	Het
Htatip2	T	C	7: 49,773,311	C205R	possibly damaging	Het
Igf2r	T	C	17: 12,717,274		probably null	Het
Ints2	T	C	11: 86,233,196	I589V	probably benign	Het
Itgae	T	A	11: 73,114,907	V299D	probably damaging	Het
Kcnma1	T	C	14: 23,509,784		probably benign	Het
Kif11	A	G	19: 37,413,117		probably benign	Het
Kif13a	A	G	13: 46,778,888		probably benign	Het
Kif18a	T	A	2: 109,298,322		probably benign	Het
Klhl29	T	C	12: 5,094,883	T406A	probably benign	Het
Litaf	A	T	16: 10,966,412		probably benign	Het
Lmntd1	T	A	6: 145,430,000	I71F	probably benign	Het
Lrit3	A	C	3: 129,788,555	C594W	probably damaging	Het
Lrp6	T	A	6: 134,479,775	Q842L	possibly damaging	Het
Lrrcc1	T	A	3: 14,540,119		probably benign	Het
Macf1	A	T	4: 123,455,524	L1829*	probably null	Het
Mapk1ip1	T	C	7: 138,835,955	T249A	possibly damaging	Het
Mfap4	T	C	11: 61,487,180	F173L	probably damaging	Het
Mfsd9	C	A	1: 40,790,474		probably benign	Het
Mgat4b	T	C	11: 50,230,763	S69P	probably damaging	Het
Mki67	A	T	7: 135,704,388	V620D	probably damaging	Het
Moxd1	C	T	10: 24,252,954	T201I	probably damaging	Het
Msh4	G	C	3: 153,866,420	D774E	probably benign	Het
Myg1	C	T	15: 102,331,849	R37C	probably benign	Het
Myrf	C	A	19: 10,228,882	A57S	probably benign	Het
Ndst1	G	A	18: 60,700,359		probably benign	Het
Nedd4l	A	T	18: 65,208,503		probably benign	Het
Neil2	T	A	14: 63,183,400	I281F	possibly damaging	Het
Nfatc2	T	A	2: 168,590,115	D26V	probably benign	Het
Nt5c	A	G	11: 115,490,714		probably null	Het
Olfr1095	T	C	2: 86,850,967	T244A	probably benign	Het
Olfr1369-ps1	G	T	13: 21,115,908	C72F	probably damaging	Het
Olfr202	A	G	16: 59,284,207	C97R	possibly damaging	Het
Olfr372	T	A	8: 72,058,322	I214N	probably damaging	Het
Olfr538	T	G	7: 140,574,507	M118R	probably damaging	Het
Ovch2	A	G	7: 107,782,021	S557P	probably benign	Het
Pik3cg	A	G	12: 32,205,203	S262P	probably benign	Het
Pla2g6	T	A	15: 79,306,396	H322L	probably damaging	Het
Plch1	A	T	3: 63,699,219	L1079Q	probably benign	Het
Plekhg4	T	A	8: 105,379,302	V777D	probably damaging	Het
Plekhg5	A	G	4: 152,112,419	D747G	possibly damaging	Het
Poln	C	A	5: 34,118,958	V318F	possibly damaging	Het
Pou5f2	T	A	13: 78,025,754	S272T	probably benign	Het
Ppp1r3e	T	G	14: 54,876,616	S200R	possibly damaging	Het
Prl7d1	G	A	13: 27,710,182	P135S	probably benign	Het
Ptgs2	G	A	1: 150,104,537	V409I	probably benign	Het
Ptk2b	T	C	14: 66,177,751	T276A	probably damaging	Het
Ptpn3	T	C	4: 57,204,921	T747A	probably damaging	Het
Qrfpr	A	G	3: 36,221,989	I84T	probably damaging	Het
Rab44	A	G	17: 29,139,144	D102G	possibly damaging	Het
Rnf125	A	T	18: 20,979,083	D57V	possibly damaging	Het
Rnf145	T	C	11: 44,560,024	F392L	probably damaging	Het
Rttn	A	G	18: 88,989,546	N435S	probably benign	Het
Scn8a	A	G	15: 101,035,537	T1500A	probably damaging	Het
Sgsm1	A	G	5: 113,285,123		probably benign	Het
Sgsm3	A	T	15: 81,011,736	*751C	probably null	Het
Slc35c2	A	C	2: 165,280,929	L145R	probably damaging	Het
Slc4a7	A	T	14: 14,757,382	E396V	probably damaging	Het
Smarca4	G	C	9: 21,658,984		probably benign	Het
Snapc3	T	A	4: 83,417,802	V17D	probably damaging	Het
Snta1	G	T	2: 154,377,072	Q448K	probably benign	Het
Sptbn2	A	G	19: 4,739,986	D1334G	probably benign	Het
Stard5	A	G	7: 83,632,757	R41G	probably damaging	Het
Tmem135	T	A	7: 89,143,788	K413*	probably null	Het
Tmem38a	G	A	8: 72,580,018	V114I	probably benign	Het
Tpr	A	G	1: 150,422,531	T1057A	probably damaging	Het
Ttc23l	A	T	15: 10,539,980	L139Q	probably damaging	Het
Ttn	T	A	2: 76,755,296		probably null	Het
Tuba3b	A	G	6: 145,619,576	T257A	probably damaging	Het
Tubgcp6	A	C	15: 89,100,987	Y1633D	probably damaging	Het
Txnl1	C	T	18: 63,671,573		probably benign	Het
Unc13b	A	G	4: 43,182,849	Q3186R	possibly damaging	Het
Vmn2r75	T	A	7: 86,163,270	S514C	probably null	Het
Whrn	G	A	4: 63,419,489	T545I	probably damaging	Het
Zdhhc20	T	C	14: 57,857,640	H154R	probably damaging	Het
Zfp462	A	T	4: 55,007,563	M1L	possibly damaging	Het
Zfp831	A	G	2: 174,645,290	K586R	possibly damaging	Het
Zfp990	A	T	4: 145,537,302	H290L	possibly damaging	Het
Zfpm1	C	T	8: 122,336,874		probably benign	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4572:Stxbp5	UTSW	10	9838144	missense	probably damaging	0.99
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
R9172:Stxbp5	UTSW	10	9769408	missense	possibly damaging	0.94
R9472:Stxbp5	UTSW	10	9843357	missense	probably damaging	1.00
R9513:Stxbp5	UTSW	10	9812010	missense	probably benign	0.17
R9649:Stxbp5	UTSW	10	9899194	missense	probably damaging	0.96
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGCATTGCATGGAGCAACGATTAGA -3'
(R):5'- GGGCTTAAGGGGAAAGTAATCCCCA -3'

Sequencing Primer
(F):5'- TCTATTTCCTACCTAGATCATTGGC -3'
(R):5'- GTAATCCCCAATTTGGAAGGTG -3'

Posted On

2013-07-11