Incidental Mutation 'R7480:Xpo6'
ID579742
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Nameexportin 6
Synonyms2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.755) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126101715-126200501 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 126102333 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1112 (R1112*)
Ref Sequence ENSEMBL: ENSMUSP00000130527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000165608] [ENSMUST00000166719] [ENSMUST00000168189] [ENSMUST00000171861]
Predicted Effect probably null
Transcript: ENSMUST00000009344
AA Change: R1111*
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: R1111*

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165608
Predicted Effect probably benign
Transcript: ENSMUST00000166719
Predicted Effect probably null
Transcript: ENSMUST00000168189
AA Change: R1112*
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: R1112*

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168564
SMART Domains Protein: ENSMUSP00000129881
Gene: ENSMUSG00000000131

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171861
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R7480_xpo6_742 UTSW 7 126102333 nonsense probably null
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R1671:Xpo6 UTSW 7 126108543 missense possibly damaging 0.92
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4231:Xpo6 UTSW 7 126174182 missense possibly damaging 0.66
R4569:Xpo6 UTSW 7 126128255 missense probably damaging 1.00
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6256:Xpo6 UTSW 7 126108619 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7630:Xpo6 UTSW 7 126140389 splice site probably null
R7794:Xpo6 UTSW 7 126160863 missense probably damaging 0.98
R7984:Xpo6 UTSW 7 126120444 missense probably benign
R8022:Xpo6 UTSW 7 126169254 missense probably benign 0.04
R8283:Xpo6 UTSW 7 126128249 missense possibly damaging 0.90
R8438:Xpo6 UTSW 7 126160882 missense possibly damaging 0.71
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACTCCAAAACCTGCTGTGC -3'
(R):5'- TGTTTGCATAGAGCCAAAAGC -3'

Sequencing Primer
(F):5'- AGAGGCAGGCCACTTGCTC -3'
(R):5'- GCCAAAAGCACAGGTGTGG -3'
Posted On2019-10-07