Incidental Mutation 'R7480:Olfr866'
ID579747
Institutional Source Beutler Lab
Gene Symbol Olfr866
Ensembl Gene ENSMUSG00000050803
Gene Nameolfactory receptor 866
SynonymsMOR145-5, GA_x6K02T2PVTD-13768406-13767468
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20026959-20028035 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to T at 20027934 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000054864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062248]
Predicted Effect probably null
Transcript: ENSMUST00000062248
AA Change: M1I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054864
Gene: ENSMUSG00000050803
AA Change: M1I

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 2e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 282 8.7e-7 PFAM
Pfam:7tm_1 44 293 5.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Olfr866
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr866 APN 9 20027047 missense probably damaging 1.00
IGL01554:Olfr866 APN 9 20027408 missense possibly damaging 0.55
IGL01561:Olfr866 APN 9 20027522 missense probably benign 0.20
IGL01597:Olfr866 APN 9 20027686 missense probably damaging 0.98
IGL02986:Olfr866 APN 9 20027711 missense probably benign 0.43
IGL03101:Olfr866 APN 9 20027429 missense probably benign 0.03
R0863:Olfr866 UTSW 9 20027213 missense probably damaging 1.00
R1747:Olfr866 UTSW 9 20027317 missense probably benign 0.01
R2121:Olfr866 UTSW 9 20027501 missense probably benign
R2124:Olfr866 UTSW 9 20027501 missense probably benign
R2240:Olfr866 UTSW 9 20027144 missense probably damaging 1.00
R3793:Olfr866 UTSW 9 20027063 missense probably damaging 1.00
R4498:Olfr866 UTSW 9 20027733 missense possibly damaging 0.50
R5084:Olfr866 UTSW 9 20027255 missense probably damaging 0.99
R5420:Olfr866 UTSW 9 20027059 missense probably damaging 0.98
R6314:Olfr866 UTSW 9 20027662 missense probably damaging 0.98
R6357:Olfr866 UTSW 9 20027629 missense probably damaging 1.00
R6588:Olfr866 UTSW 9 20027866 missense probably damaging 0.97
R6886:Olfr866 UTSW 9 20027132 missense probably benign 0.00
Z1088:Olfr866 UTSW 9 20027279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCACAATCATCTTTGGG -3'
(R):5'- CTCTATTGTGCACCTGTTTATGAG -3'

Sequencing Primer
(F):5'- TATCAATCAAAGATAAGTTGGACAGG -3'
(R):5'- CACCTGTTTATGAGGATGTAATTGTC -3'
Posted On2019-10-07