Incidental Mutation 'R7480:Dapk1'
ID579760
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60757497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1007 (D1007G)
Ref Sequence ENSEMBL: ENSMUSP00000076666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: D1007G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: D1007G

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: D1007G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: D1007G

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: D1007G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R1799:Dapk1 UTSW 13 60719654 missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60696395 missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60761785 missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60754210 missense probably benign 0.02
R7203:Dapk1 UTSW 13 60696335 missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60719641 missense probably benign 0.00
R7448:Dapk1 UTSW 13 60751176 missense probably damaging 1.00
R7532:Dapk1 UTSW 13 60730886 missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60761173 missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60761551 missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60751193 missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60725339 missense probably benign 0.41
R7822:Dapk1 UTSW 13 60725901 missense probably benign 0.05
Z1176:Dapk1 UTSW 13 60760804 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGATGAATACCGTCGCTCAC -3'
(R):5'- ACTCTGAGCTAACACTAAGGAGG -3'

Sequencing Primer
(F):5'- CACAGTTGTGCAGTGGCTAAC -3'
(R):5'- TCTGAGCTAACACTAAGGAGGAGAGG -3'
Posted On2019-10-07