Incidental Mutation 'R7480:Thbs4'
ID579761
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Namethrombospondin 4
SynonymsTSP-4, TSP4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location92751590-92794818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 92767221 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 429 (P429L)
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
Predicted Effect probably benign
Transcript: ENSMUST00000022213
AA Change: P429L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: P429L

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92776980 missense probably benign 0.04
IGL02318:Thbs4 APN 13 92763584 missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92790798 missense probably benign 0.00
IGL03205:Thbs4 APN 13 92762774 missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92769548 missense probably benign 0.37
R0087:Thbs4 UTSW 13 92755235 missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0130:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0276:Thbs4 UTSW 13 92775532 missense probably benign 0.00
R0423:Thbs4 UTSW 13 92756571 missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92767184 missense probably benign 0.04
R0708:Thbs4 UTSW 13 92773186 missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92758038 missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92762926 splice site probably benign
R1139:Thbs4 UTSW 13 92774718 missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92776905 missense probably benign 0.17
R1342:Thbs4 UTSW 13 92752417 missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92761533 missense probably benign
R1834:Thbs4 UTSW 13 92761481 missense probably benign 0.00
R1950:Thbs4 UTSW 13 92769571 missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92790879 missense probably benign 0.00
R2184:Thbs4 UTSW 13 92774794 missense probably benign
R2198:Thbs4 UTSW 13 92763271 missense possibly damaging 0.78
R2859:Thbs4 UTSW 13 92790708 missense probably benign 0.02
R3605:Thbs4 UTSW 13 92757959 nonsense probably null
R3783:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3784:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3786:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3787:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R4061:Thbs4 UTSW 13 92776097 critical splice donor site probably null
R4790:Thbs4 UTSW 13 92762806 missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92758068 missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92790699 missense probably benign 0.29
R5185:Thbs4 UTSW 13 92775167 missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92763590 missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92776993 missense probably benign
R5589:Thbs4 UTSW 13 92776074 intron probably null
R5700:Thbs4 UTSW 13 92776953 missense probably benign 0.00
R6061:Thbs4 UTSW 13 92751795 missense probably benign 0.00
R6101:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92774682 missense probably null 1.00
R6249:Thbs4 UTSW 13 92774707 missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92756536 missense probably benign 0.06
R6735:Thbs4 UTSW 13 92755166 missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92762869 missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92757936 missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92773259 nonsense probably null
R7682:Thbs4 UTSW 13 92775562 missense probably benign 0.21
R8022:Thbs4 UTSW 13 92752447 missense probably damaging 1.00
Z1177:Thbs4 UTSW 13 92754376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAGTGTTAATCTGACC -3'
(R):5'- TTCACCGACATGCCTAGGAG -3'

Sequencing Primer
(F):5'- CCAGTGTTAATCTGACCTGAGTATAC -3'
(R):5'- AGAGCTATGGGTCTTTATGCTCAGTC -3'
Posted On2019-10-07