Incidental Mutation 'R7480:Rai14'
ID579762
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Nameretinoic acid induced 14
Synonyms1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10568969-10714624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10571536 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 940 (E940D)
Ref Sequence ENSEMBL: ENSMUSP00000087815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
Predicted Effect probably benign
Transcript: ENSMUST00000090339
AA Change: E940D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: E940D

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169385
AA Change: E940D

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: E940D

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000227506
AA Change: E911D

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Slc8a1 T C 17: 81,649,220 T130A probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10599711 splice site probably benign
IGL01625:Rai14 APN 15 10572374 missense probably benign 0.30
IGL01925:Rai14 APN 15 10595862 missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10633156 missense probably benign 0.00
IGL02531:Rai14 APN 15 10574782 missense probably damaging 1.00
IGL02748:Rai14 APN 15 10589335 missense probably benign 0.14
IGL02945:Rai14 APN 15 10574709 missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10575156 missense probably damaging 1.00
R1400:Rai14 UTSW 15 10571548 missense probably damaging 0.98
R1583:Rai14 UTSW 15 10587916 missense probably damaging 1.00
R1686:Rai14 UTSW 15 10592196 missense probably damaging 0.98
R1721:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1867:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1868:Rai14 UTSW 15 10633228 missense probably damaging 1.00
R1998:Rai14 UTSW 15 10594981 splice site probably null
R2118:Rai14 UTSW 15 10575166 missense probably benign 0.00
R3161:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10633164 missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10592212 missense probably benign 0.30
R4611:Rai14 UTSW 15 10592138 missense probably damaging 1.00
R4760:Rai14 UTSW 15 10575690 missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10572470 missense probably damaging 0.99
R5022:Rai14 UTSW 15 10574506 missense probably damaging 0.96
R5110:Rai14 UTSW 15 10690410 start gained probably benign
R5410:Rai14 UTSW 15 10574938 missense probably damaging 1.00
R5643:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5644:Rai14 UTSW 15 10593051 missense probably benign 0.03
R5681:Rai14 UTSW 15 10575120 missense probably damaging 1.00
R5934:Rai14 UTSW 15 10575159 missense probably damaging 0.98
R6333:Rai14 UTSW 15 10574936 nonsense probably null
R6338:Rai14 UTSW 15 10574976 missense probably damaging 1.00
R6864:Rai14 UTSW 15 10633168 missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10589315 nonsense probably null
R7155:Rai14 UTSW 15 10595003 missense possibly damaging 0.53
R7574:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7578:Rai14 UTSW 15 10574828 missense probably benign
R7578:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7597:Rai14 UTSW 15 10574851 missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10593103 missense probably damaging 1.00
R7779:Rai14 UTSW 15 10593026 missense probably damaging 1.00
R7946:Rai14 UTSW 15 10574201 splice site probably null
R8171:Rai14 UTSW 15 10633163 missense probably damaging 1.00
R8195:Rai14 UTSW 15 10575216 missense probably benign
R8471:Rai14 UTSW 15 10575159 missense probably benign 0.01
R8485:Rai14 UTSW 15 10575036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACATCTGCTGCCTCATTATTGTAAC -3'
(R):5'- GTGAATTTAGCAAATCTAGGAGCTTCC -3'

Sequencing Primer
(F):5'- GCTGGTCTCAAACTCACGATATAG -3'
(R):5'- GGAGCTTCCTGTGCTAACATACAG -3'
Posted On2019-10-07