Incidental Mutation 'R7480:Slc8a1'
ID579770
Institutional Source Beutler Lab
Gene Symbol Slc8a1
Ensembl Gene ENSMUSG00000054640
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 1
SynonymsNcx1, D930008O12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7480 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location81388691-81649607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81649220 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 130 (T130A)
Ref Sequence ENSEMBL: ENSMUSP00000132809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]
Predicted Effect probably damaging
Transcript: ENSMUST00000086538
AA Change: T130A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: T130A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163123
AA Change: T130A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: T130A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 87 246 4.6e-38 PFAM
coiled coil region 313 332 N/A INTRINSIC
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 742 753 N/A INTRINSIC
Pfam:Na_Ca_ex 794 947 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163680
AA Change: T130A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: T130A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T G 5: 24,546,906 E498A probably damaging Het
Alg9 T G 9: 50,822,628 M542R probably benign Het
Apol10b G T 15: 77,588,788 A22D probably benign Het
Arhgap45 T A 10: 80,027,102 L704* probably null Het
Bicc1 T C 10: 70,943,476 D694G probably damaging Het
C1ql3 A T 2: 13,010,339 I170N probably damaging Het
Casz1 T C 4: 148,944,586 F1163L probably damaging Het
Ces2f A G 8: 104,954,706 K559R possibly damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Cr2 C T 1: 195,154,176 C893Y probably damaging Het
Csf1r T G 18: 61,117,538 D440E probably benign Het
Cul9 A T 17: 46,537,812 M666K probably benign Het
Dapk1 A G 13: 60,757,497 D1007G probably benign Het
Dlk1 T A 12: 109,455,614 C85S probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Epb41l3 A C 17: 69,261,872 probably null Het
Eri2 T A 7: 119,786,511 R256* probably null Het
Fam71f2 G A 6: 29,281,436 probably null Het
Fshr A C 17: 88,985,374 Y625* probably null Het
Galk2 A G 2: 125,946,925 I300V probably benign Het
Gm3409 T A 5: 146,539,501 V154E probably damaging Het
Gm7356 A G 17: 14,001,065 I234T possibly damaging Het
Gtf3c1 T C 7: 125,642,541 Y1995C probably benign Het
Herc6 C T 6: 57,581,221 T62I possibly damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Hmcn1 A T 1: 150,677,234 probably null Het
Jrk G T 15: 74,707,053 P128T probably benign Het
Kctd14 T C 7: 97,458,224 F229L probably benign Het
Kif27 A T 13: 58,288,211 V1256E probably benign Het
Klk13 T C 7: 43,721,422 S133P probably benign Het
Mpzl1 A G 1: 165,604,688 V176A possibly damaging Het
Mxi1 A G 19: 53,371,635 T263A possibly damaging Het
Nfxl1 C T 5: 72,559,252 W5* probably null Het
Nt5dc1 C A 10: 34,324,453 G190V probably damaging Het
Nt5dc1 C T 10: 34,324,454 G190R probably damaging Het
Olfr1282 A G 2: 111,335,392 S229P probably benign Het
Olfr161 A T 16: 3,592,629 T78S probably benign Het
Olfr308 A G 7: 86,321,680 S91P probably benign Het
Olfr866 C T 9: 20,027,934 M1I probably null Het
Oprd1 A G 4: 132,117,181 I172T possibly damaging Het
Pafah1b1 A C 11: 74,685,914 C184G probably damaging Het
Pde5a A T 3: 122,803,148 N495Y possibly damaging Het
Piezo1 A T 8: 122,498,495 Y588* probably null Het
Plekha7 A T 7: 116,137,168 probably null Het
Pramef6 T C 4: 143,895,495 D430G probably benign Het
Prdm11 T C 2: 92,975,324 K427R probably benign Het
Rai14 C A 15: 10,571,536 E940D probably benign Het
Rasl11b T A 5: 74,198,110 V92E possibly damaging Het
Rassf8 T A 6: 145,820,031 I29K unknown Het
Reg3a C T 6: 78,382,347 T110I probably damaging Het
Scaf1 C T 7: 45,007,649 G602D unknown Het
Senp6 T C 9: 80,121,917 C521R probably damaging Het
Senp7 G A 16: 56,155,226 V432I possibly damaging Het
Skint8 A T 4: 111,928,587 R77* probably null Het
Slamf9 G A 1: 172,477,473 C218Y probably damaging Het
Smpdl3a A G 10: 57,802,478 I126V possibly damaging Het
Taar9 T A 10: 24,108,945 N197I possibly damaging Het
Tango6 A T 8: 106,696,727 D378V possibly damaging Het
Tfb2m A G 1: 179,529,182 F396L probably benign Het
Thbs4 G A 13: 92,767,221 P429L probably benign Het
Tnxb A G 17: 34,715,773 D2452G probably damaging Het
Ulk3 C T 9: 57,591,240 R131* probably null Het
Vmn1r179 A T 7: 23,929,133 R250* probably null Het
Vmn1r54 A G 6: 90,269,178 I25V possibly damaging Het
Wnt7a C A 6: 91,394,413 R189L probably benign Het
Wrap73 A G 4: 154,152,586 D210G probably benign Het
Xpo6 G A 7: 126,102,333 R1112* probably null Het
Zfp114 T A 7: 24,181,882 V552D probably damaging Het
Other mutations in Slc8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Slc8a1 APN 17 81649171 missense probably damaging 1.00
IGL00572:Slc8a1 APN 17 81388726 missense probably damaging 1.00
IGL00777:Slc8a1 APN 17 81648580 missense probably damaging 1.00
IGL00857:Slc8a1 APN 17 81647879 missense probably benign 0.03
IGL01068:Slc8a1 APN 17 81388942 missense probably benign 0.09
IGL01089:Slc8a1 APN 17 81648281 missense probably damaging 1.00
IGL01089:Slc8a1 APN 17 81388881 missense probably damaging 1.00
IGL01510:Slc8a1 APN 17 81648365 missense probably damaging 1.00
IGL01677:Slc8a1 APN 17 81648607 missense probably damaging 1.00
IGL01862:Slc8a1 APN 17 81442201 critical splice donor site probably null
IGL02003:Slc8a1 APN 17 81428196 missense possibly damaging 0.80
IGL02500:Slc8a1 APN 17 81388713 missense probably damaging 1.00
IGL02556:Slc8a1 APN 17 81648744 missense probably benign 0.24
IGL02800:Slc8a1 APN 17 81408323 missense probably benign 0.01
IGL03308:Slc8a1 APN 17 81442195 unclassified probably benign
IGL03391:Slc8a1 APN 17 81432638 splice site probably benign
cardinal UTSW 17 81648407 missense probably damaging 0.99
encyclical UTSW 17 81649454 missense probably damaging 1.00
PIT4498001:Slc8a1 UTSW 17 81648840 nonsense probably null
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0485:Slc8a1 UTSW 17 81647993 missense probably damaging 0.99
R0667:Slc8a1 UTSW 17 81648881 missense probably damaging 1.00
R0845:Slc8a1 UTSW 17 81437748 missense probably benign 0.05
R1073:Slc8a1 UTSW 17 81648407 missense probably damaging 0.99
R1417:Slc8a1 UTSW 17 81408280 missense probably damaging 1.00
R1510:Slc8a1 UTSW 17 81648118 missense probably damaging 1.00
R1546:Slc8a1 UTSW 17 81648247 missense probably damaging 1.00
R1625:Slc8a1 UTSW 17 81649241 missense probably damaging 1.00
R1806:Slc8a1 UTSW 17 81648487 missense probably damaging 1.00
R1879:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R2025:Slc8a1 UTSW 17 81649112 missense probably damaging 1.00
R2187:Slc8a1 UTSW 17 81648553 missense possibly damaging 0.48
R2198:Slc8a1 UTSW 17 81408256 nonsense probably null
R3856:Slc8a1 UTSW 17 81648374 missense probably benign
R4067:Slc8a1 UTSW 17 81648274 missense probably damaging 1.00
R4224:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R4225:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R5028:Slc8a1 UTSW 17 81649273 missense possibly damaging 0.91
R5307:Slc8a1 UTSW 17 81649224 missense probably damaging 1.00
R5766:Slc8a1 UTSW 17 81648961 missense probably damaging 0.97
R5787:Slc8a1 UTSW 17 81388737 missense probably damaging 1.00
R5902:Slc8a1 UTSW 17 81408082 missense probably damaging 1.00
R5913:Slc8a1 UTSW 17 81648002 missense probably damaging 1.00
R6017:Slc8a1 UTSW 17 81648254 missense probably damaging 1.00
R6481:Slc8a1 UTSW 17 81388918 missense probably benign
R6670:Slc8a1 UTSW 17 81649454 missense probably damaging 1.00
R6714:Slc8a1 UTSW 17 81408249 missense probably damaging 1.00
R6914:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R6919:Slc8a1 UTSW 17 81388872 missense probably damaging 1.00
R6942:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R7057:Slc8a1 UTSW 17 81649095 missense probably damaging 1.00
R7431:Slc8a1 UTSW 17 81441663 missense probably benign 0.00
R7447:Slc8a1 UTSW 17 81649006 missense probably damaging 1.00
R7572:Slc8a1 UTSW 17 81441771 critical splice donor site probably null
R8056:Slc8a1 UTSW 17 81647923 missense probably damaging 1.00
X0024:Slc8a1 UTSW 17 81432762 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACGCAGATGCTTGATCTTCC -3'
(R):5'- CCCCAAGACCCATCTTTTGG -3'

Sequencing Primer
(F):5'- TCTCTCCATCAGGGACCACG -3'
(R):5'- TGGGGACAAAATTGCTAGAGC -3'
Posted On2019-10-07