Incidental Mutation 'R7481:Col19a1'
ID579774
Institutional Source Beutler Lab
Gene Symbol Col19a1
Ensembl Gene ENSMUSG00000026141
Gene Namecollagen, type XIX, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location24261890-24587472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24317707 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 632 (G632R)
Ref Sequence ENSEMBL: ENSMUSP00000110899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051344] [ENSMUST00000115244]
Predicted Effect probably damaging
Transcript: ENSMUST00000051344
AA Change: G632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052606
Gene: ENSMUSG00000026141
AA Change: G632R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 349 1e-9 PFAM
Pfam:Collagen 325 391 2.2e-10 PFAM
Pfam:Collagen 376 442 1.4e-8 PFAM
Pfam:Collagen 436 500 2.9e-9 PFAM
Pfam:Collagen 474 536 6.3e-10 PFAM
Pfam:Collagen 519 579 5.6e-10 PFAM
Pfam:Collagen 559 620 1.2e-8 PFAM
Pfam:Collagen 619 675 8.7e-11 PFAM
Pfam:Collagen 697 774 2.4e-8 PFAM
Pfam:Collagen 753 819 8.7e-10 PFAM
Pfam:Collagen 831 892 8.8e-12 PFAM
internal_repeat_2 905 943 3.52e-11 PROSPERO
internal_repeat_1 905 980 8.61e-26 PROSPERO
internal_repeat_2 947 982 3.52e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115244
AA Change: G632R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110899
Gene: ENSMUSG00000026141
AA Change: G632R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 47 231 1.61e-63 SMART
low complexity region 254 266 N/A INTRINSIC
Pfam:Collagen 288 347 3.1e-9 PFAM
Pfam:Collagen 330 391 1.1e-9 PFAM
internal_repeat_4 455 492 1.88e-5 PROSPERO
Pfam:Collagen 519 579 2e-9 PFAM
Pfam:Collagen 559 620 4.9e-8 PFAM
Pfam:Collagen 619 675 3.5e-10 PFAM
low complexity region 723 741 N/A INTRINSIC
Pfam:Collagen 753 819 2.8e-9 PFAM
Pfam:Collagen 831 892 3.9e-11 PFAM
internal_repeat_2 905 943 1.18e-11 PROSPERO
internal_repeat_1 905 980 8.89e-27 PROSPERO
internal_repeat_2 947 982 1.18e-11 PROSPERO
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1048 1069 N/A INTRINSIC
low complexity region 1078 1115 N/A INTRINSIC
Meta Mutation Damage Score 0.9290 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3' UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality resulting from impaired swallowing, abnormal esophageal muscle development, and impaired muscle relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Col19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col19a1 APN 1 24561306 missense unknown
IGL00514:Col19a1 APN 1 24536932 missense unknown
IGL00756:Col19a1 APN 1 24322942 missense possibly damaging 0.85
IGL01408:Col19a1 APN 1 24306250 splice site probably benign
IGL01608:Col19a1 APN 1 24282545 missense probably damaging 1.00
IGL01664:Col19a1 APN 1 24561335 missense unknown
IGL01906:Col19a1 APN 1 24317429 missense probably damaging 1.00
IGL01916:Col19a1 APN 1 24534241 missense unknown
IGL02040:Col19a1 APN 1 24312045 critical splice donor site probably null
IGL02407:Col19a1 APN 1 24312372 splice site probably null
IGL02505:Col19a1 APN 1 24300584 splice site probably benign
IGL02606:Col19a1 APN 1 24534116 nonsense probably null
IGL02659:Col19a1 APN 1 24534034 missense unknown
IGL02815:Col19a1 APN 1 24285251 splice site probably null
IGL02880:Col19a1 APN 1 24325973 splice site probably benign
IGL02897:Col19a1 APN 1 24534098 missense unknown
IGL03102:Col19a1 APN 1 24328053 missense probably damaging 1.00
R0038:Col19a1 UTSW 1 24559744 missense unknown
R0109:Col19a1 UTSW 1 24559768 splice site probably null
R0124:Col19a1 UTSW 1 24526458 missense unknown
R0326:Col19a1 UTSW 1 24285051 critical splice donor site probably null
R0390:Col19a1 UTSW 1 24289655 splice site probably benign
R0675:Col19a1 UTSW 1 24575455 start gained probably benign
R0826:Col19a1 UTSW 1 24526386 missense unknown
R0948:Col19a1 UTSW 1 24296801 missense probably damaging 0.98
R1014:Col19a1 UTSW 1 24301273 critical splice donor site probably null
R1619:Col19a1 UTSW 1 24534091 missense unknown
R1691:Col19a1 UTSW 1 24536941 missense unknown
R1878:Col19a1 UTSW 1 24317395 missense probably benign 0.40
R1901:Col19a1 UTSW 1 24536997 missense unknown
R1928:Col19a1 UTSW 1 24451754 splice site probably benign
R1940:Col19a1 UTSW 1 24264750 nonsense probably null
R2015:Col19a1 UTSW 1 24559753 missense unknown
R2571:Col19a1 UTSW 1 24374631 missense unknown
R2844:Col19a1 UTSW 1 24559681 missense unknown
R2845:Col19a1 UTSW 1 24559681 missense unknown
R3107:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R3861:Col19a1 UTSW 1 24326017 missense probably damaging 1.00
R3872:Col19a1 UTSW 1 24575327 splice site probably benign
R4180:Col19a1 UTSW 1 24270392 missense probably damaging 1.00
R4195:Col19a1 UTSW 1 24534052 missense unknown
R4196:Col19a1 UTSW 1 24534052 missense unknown
R4234:Col19a1 UTSW 1 24315395 splice site probably null
R4250:Col19a1 UTSW 1 24525645 missense unknown
R4396:Col19a1 UTSW 1 24510866 missense unknown
R4405:Col19a1 UTSW 1 24534109 missense unknown
R4450:Col19a1 UTSW 1 24322035 missense probably damaging 0.96
R4583:Col19a1 UTSW 1 24561329 missense unknown
R4980:Col19a1 UTSW 1 24526483 missense unknown
R5222:Col19a1 UTSW 1 24559640 splice site probably null
R5407:Col19a1 UTSW 1 24303494 missense probably damaging 0.99
R5439:Col19a1 UTSW 1 24293112 missense probably damaging 1.00
R5739:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5740:Col19a1 UTSW 1 24337915 missense probably damaging 1.00
R5891:Col19a1 UTSW 1 24289725 missense probably damaging 1.00
R5996:Col19a1 UTSW 1 24328071 missense probably damaging 1.00
R6074:Col19a1 UTSW 1 24526483 missense unknown
R6152:Col19a1 UTSW 1 24374621 missense unknown
R6191:Col19a1 UTSW 1 24317393 missense probably damaging 1.00
R6236:Col19a1 UTSW 1 24279949 missense probably damaging 1.00
R6315:Col19a1 UTSW 1 24526452 missense unknown
R6709:Col19a1 UTSW 1 24282496 missense probably damaging 1.00
R6748:Col19a1 UTSW 1 24534070 missense unknown
R7098:Col19a1 UTSW 1 24526474 missense unknown
R7114:Col19a1 UTSW 1 24337936 missense possibly damaging 0.71
R7292:Col19a1 UTSW 1 24530008 missense unknown
R7392:Col19a1 UTSW 1 24534034 missense unknown
R7478:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7480:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7512:Col19a1 UTSW 1 24317707 missense probably damaging 1.00
R7618:Col19a1 UTSW 1 24322084 missense probably benign 0.07
R7698:Col19a1 UTSW 1 24312078 missense probably benign 0.09
R7711:Col19a1 UTSW 1 24530008 missense unknown
R7725:Col19a1 UTSW 1 24270444 missense possibly damaging 0.94
R7831:Col19a1 UTSW 1 24526482 missense unknown
R8252:Col19a1 UTSW 1 24279967 missense probably benign 0.05
Z1088:Col19a1 UTSW 1 24279940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATGTCCTTACGTCATTCCC -3'
(R):5'- GCATGTGCGAGCAAAGTCTC -3'

Sequencing Primer
(F):5'- CTGGCATCCCTGGAGTTC -3'
(R):5'- CATACTTCTAGCCTCGGATAGTTGG -3'
Posted On2019-10-07