Incidental Mutation 'R7481:Sec24d'
ID579791
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene NameSec24 related gene family, member D (S. cerevisiae)
Synonyms2310020L09Rik, LOC383951
MMRRC Submission
Accession Numbers

Genbank: NM_027135; MGI: 1916858

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location123267455-123365641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123350763 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 630 (C630R)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: C630R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: C630R

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGCCCAGTCTACCTATGCAG -3'
(R):5'- CCCATCTGAAGCAACACATGTG -3'

Sequencing Primer
(F):5'- TGCAGAGGGAAAAAATTCCA -3'
(R):5'- GTGTGCACACATATACTCAAGC -3'
Posted On2019-10-07