Incidental Mutation 'R7481:Selplg'
ID579795
Institutional Source Beutler Lab
Gene Symbol Selplg
Ensembl Gene ENSMUSG00000048163
Gene Nameselectin, platelet (p-selectin) ligand
SynonymsPsgl-1, CD162, Psgl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7481 (G1)
Quality Score189.458
Status Not validated
Chromosome5
Chromosomal Location113818536-113832644 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT at 113819695 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000100874] [ENSMUST00000199109]
Predicted Effect probably benign
Transcript: ENSMUST00000100874
SMART Domains Protein: ENSMUSP00000098436
Gene: ENSMUSG00000048163

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
internal_repeat_2 130 182 2.38e-13 PROSPERO
internal_repeat_1 133 186 5.75e-16 PROSPERO
internal_repeat_1 193 246 5.75e-16 PROSPERO
internal_repeat_2 200 252 2.38e-13 PROSPERO
transmembrane domain 328 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199109
Predicted Effect probably benign
Transcript: ENSMUST00000201194
Predicted Effect probably benign
Transcript: ENSMUST00000201931
Predicted Effect probably benign
Transcript: ENSMUST00000202555
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that functions as a high affinity counter-receptor for the cell adhesion molecules P-, E- and L- selectin expressed on myeloid cells and stimulated T lymphocytes. As such, this protein plays a critical role in leukocyte trafficking during inflammation by tethering of leukocytes to activated platelets or endothelia expressing selectins. This protein requires two post-translational modifications, tyrosine sulfation and the addition of the sialyl Lewis x tetrasaccharide (sLex) to its O-linked glycans, for its high-affinity binding activity. Aberrant expression of this gene and polymorphisms in this gene are associated with defects in the innate and adaptive immune response. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neutrophillia and impaired leukocyte adhesion and rolling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Selplg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Selplg APN 5 113819468 missense probably damaging 1.00
IGL01488:Selplg APN 5 113819636 missense possibly damaging 0.78
IGL02355:Selplg APN 5 113819406 missense probably benign 0.00
IGL02362:Selplg APN 5 113819406 missense probably benign 0.00
PIT4142001:Selplg UTSW 5 113819628 missense probably benign 0.00
R0375:Selplg UTSW 5 113820008 missense probably damaging 0.99
R1222:Selplg UTSW 5 113819373 missense possibly damaging 0.95
R1840:Selplg UTSW 5 113819844 missense possibly damaging 0.66
R2925:Selplg UTSW 5 113820179 missense possibly damaging 0.92
R4512:Selplg UTSW 5 113819063 missense probably benign 0.05
R4702:Selplg UTSW 5 113819033 missense probably benign 0.31
R4703:Selplg UTSW 5 113819033 missense probably benign 0.31
R4704:Selplg UTSW 5 113819033 missense probably benign 0.31
R4968:Selplg UTSW 5 113819726 missense possibly damaging 0.93
R5075:Selplg UTSW 5 113819984 missense probably benign 0.00
R6159:Selplg UTSW 5 113819101 missense probably benign 0.02
R6345:Selplg UTSW 5 113820149 missense probably benign 0.03
R6550:Selplg UTSW 5 113820149 missense probably benign 0.03
R6554:Selplg UTSW 5 113820149 missense probably benign 0.03
R6997:Selplg UTSW 5 113819695 unclassified probably benign
R7050:Selplg UTSW 5 113819695 unclassified probably benign
R7094:Selplg UTSW 5 113819695 unclassified probably benign
R7235:Selplg UTSW 5 113819695 unclassified probably benign
R7604:Selplg UTSW 5 113819695 unclassified probably benign
R7674:Selplg UTSW 5 113819695 unclassified probably benign
R7846:Selplg UTSW 5 113819420 missense probably damaging 1.00
R7887:Selplg UTSW 5 113819695 unclassified probably benign
R8051:Selplg UTSW 5 113819441 missense probably damaging 0.99
Z1177:Selplg UTSW 5 113819351 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCTGCAGACGTTGTAAACAG -3'
(R):5'- GTGGAGTCTAACCTCAGTAGAGAC -3'

Sequencing Primer
(F):5'- TTTACAGCCTGAATCCTGGGAAGC -3'
(R):5'- GTCTAACCTCAGTAGAGACCGTCC -3'
Posted On2019-10-07