Incidental Mutation 'R7481:Tlnrd1'
ID579802
Institutional Source Beutler Lab
Gene Symbol Tlnrd1
Ensembl Gene ENSMUSG00000070462
Gene Nametalin rod domain containing 1
SynonymsMesdc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location83879873-83884305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83882338 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 295 (V295E)
Ref Sequence ENSEMBL: ENSMUSP00000091769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094216]
Predicted Effect probably damaging
Transcript: ENSMUST00000094216
AA Change: V295E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091769
Gene: ENSMUSG00000070462
AA Change: V295E

DomainStartEndE-ValueType
low complexity region 9 29 N/A INTRINSIC
PDB:2X0C|A 37 320 1e-21 PDB
Blast:MA 100 258 1e-5 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is regulated by micro RNA MiR-574-3, and is thought to have an oncogenic function in human bladder cancer. A similar gene in mouse is located in a chromosomal region critical for differentiation of mesoderm, which affects embryo patterning and the formation of heart, muscle, blood, skeleton and the urogenital system. The mouse gene is expressed in early development, and in the adult. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Tlnrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Tlnrd1 APN 7 83882846 missense probably damaging 1.00
IGL02662:Tlnrd1 APN 7 83882819 missense possibly damaging 0.94
IGL02662:Tlnrd1 APN 7 83882536 missense probably damaging 1.00
Danken UTSW 7 83882630 missense probably damaging 0.97
fallt UTSW 7 83882779 missense probably damaging 1.00
R2096:Tlnrd1 UTSW 7 83882854 missense probably benign 0.05
R2358:Tlnrd1 UTSW 7 83882280 missense probably benign 0.00
R5429:Tlnrd1 UTSW 7 83882314 missense probably damaging 1.00
R5910:Tlnrd1 UTSW 7 83884485 unclassified probably benign
R6004:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R6931:Tlnrd1 UTSW 7 83882597 missense probably benign 0.15
R7000:Tlnrd1 UTSW 7 83882779 missense probably damaging 1.00
R7587:Tlnrd1 UTSW 7 83882947 missense probably damaging 0.98
R7598:Tlnrd1 UTSW 7 83882630 missense probably damaging 0.97
R8047:Tlnrd1 UTSW 7 83882861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGAGTGCTAATTCACAGAATTG -3'
(R):5'- CATGCGTACGCGAAGTGAAG -3'

Sequencing Primer
(F):5'- ATTCACTGGCGGTAAAGTCC -3'
(R):5'- AAGTGAAGGCGGCACCC -3'
Posted On2019-10-07