Incidental Mutation 'R7481:Map6'
ID579804
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Namemicrotubule-associated protein 6
SynonymsF-STOP, Mtap6, 2810411E12Rik, STOP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location99267447-99337137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99269138 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 373 (T373S)
Ref Sequence ENSEMBL: ENSMUSP00000064787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208605] [ENSMUST00000208924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068973
AA Change: T373S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: T373S

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107100
AA Change: T170S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407
AA Change: T170S

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000122101
AA Change: T373S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407
AA Change: T373S

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000127492
AA Change: T373S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207883
AA Change: T373S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000208605
AA Change: T170S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208924
AA Change: T170S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0035:Map6 UTSW 7 99317608 missense probably damaging 1.00
R0118:Map6 UTSW 7 99317617 missense possibly damaging 0.53
R0125:Map6 UTSW 7 99335980 splice site probably null
R0244:Map6 UTSW 7 99336836 missense probably benign 0.00
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0973:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R0974:Map6 UTSW 7 99336743 missense possibly damaging 0.78
R1455:Map6 UTSW 7 99268214 missense probably damaging 1.00
R1678:Map6 UTSW 7 99268098 missense probably damaging 1.00
R1696:Map6 UTSW 7 99317457 splice site probably null
R1866:Map6 UTSW 7 99315876 missense probably damaging 1.00
R2061:Map6 UTSW 7 99317472 missense probably damaging 1.00
R3236:Map6 UTSW 7 99336824 missense probably damaging 1.00
R3625:Map6 UTSW 7 99269195 missense possibly damaging 0.60
R4044:Map6 UTSW 7 99268049 missense probably damaging 1.00
R4570:Map6 UTSW 7 99336556 missense possibly damaging 0.49
R5056:Map6 UTSW 7 99336652 missense probably benign 0.05
R5065:Map6 UTSW 7 99336710 missense probably benign 0.02
R5656:Map6 UTSW 7 99336298 missense probably damaging 1.00
R6101:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6105:Map6 UTSW 7 99268107 missense probably damaging 1.00
R6302:Map6 UTSW 7 99336107 missense probably damaging 0.99
R6450:Map6 UTSW 7 99268038 missense probably damaging 1.00
R6915:Map6 UTSW 7 99268247 missense probably damaging 1.00
R7205:Map6 UTSW 7 99269050 missense probably benign 0.00
R7223:Map6 UTSW 7 99268025 missense probably damaging 1.00
R7293:Map6 UTSW 7 99336533 missense possibly damaging 0.49
R7489:Map6 UTSW 7 99268061 missense probably damaging 1.00
R7691:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7693:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R7695:Map6 UTSW 7 99336292 missense possibly damaging 0.95
R8341:Map6 UTSW 7 99268440 missense possibly damaging 0.75
Z1176:Map6 UTSW 7 99317660 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATCAGCGTGACACAC -3'
(R):5'- AGCTGCTTACTGTACTCGC -3'

Sequencing Primer
(F):5'- TGGTCCTGCAGCTGGAAAG -3'
(R):5'- GCCACCTCCTCCCGGATTTG -3'
Posted On2019-10-07