Incidental Mutation 'R7481:Terf2'
ID579814
Institutional Source Beutler Lab
Gene Symbol Terf2
Ensembl Gene ENSMUSG00000031921
Gene Nametelomeric repeat binding factor 2
SynonymsTRF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location107069400-107096547 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 107072721 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068388] [ENSMUST00000068421] [ENSMUST00000116425] [ENSMUST00000133925]
Predicted Effect probably null
Transcript: ENSMUST00000068388
SMART Domains Protein: ENSMUSP00000065586
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 7.5e-39 PFAM
PDB:3K6G|F 318 356 2e-12 PDB
SANT 422 473 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068421
SMART Domains Protein: ENSMUSP00000068948
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 296 3e-38 PFAM
Pfam:TERF2_RBM 320 360 5.1e-22 PFAM
SANT 487 538 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116425
SMART Domains Protein: ENSMUSP00000112126
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 1.5e-38 PFAM
PDB:3K6G|F 319 359 4e-14 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133925
SMART Domains Protein: ENSMUSP00000118759
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 47 75 N/A INTRINSIC
low complexity region 77 96 N/A INTRINSIC
Pfam:TRF 97 297 9.9e-39 PFAM
PDB:3K6G|F 318 358 3e-14 PDB
SANT 486 537 1.71e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142616
SMART Domains Protein: ENSMUSP00000118589
Gene: ENSMUSG00000031921

DomainStartEndE-ValueType
Pfam:TRF 1 178 2.6e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a telomere specific protein, TERF2, which is a component of the telomere nucleoprotein complex. This protein is present at telomeres in metaphase of the cell cycle, is a second negative regulator of telomere length and plays a key role in the protective activity of telomeres. While having similar telomere binding activity and domain organization, TERF2 differs from TERF1 in that its N terminus is basic rather than acidic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfat G A 15: 68,178,866 Q769* probably null Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Terf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Terf2 APN 8 107072625 missense possibly damaging 0.89
IGL02879:Terf2 APN 8 107076697 missense probably benign 0.02
IGL03368:Terf2 APN 8 107070549 missense probably damaging 1.00
PIT1430001:Terf2 UTSW 8 107096302 missense probably damaging 0.98
R0454:Terf2 UTSW 8 107096210 nonsense probably null
R0615:Terf2 UTSW 8 107082990 missense possibly damaging 0.90
R1983:Terf2 UTSW 8 107083008 missense probably damaging 0.99
R3051:Terf2 UTSW 8 107079384 missense possibly damaging 0.88
R3053:Terf2 UTSW 8 107079384 missense possibly damaging 0.88
R4210:Terf2 UTSW 8 107079448 missense probably damaging 1.00
R4782:Terf2 UTSW 8 107076675 missense probably benign 0.00
R4799:Terf2 UTSW 8 107076675 missense probably benign 0.00
R4994:Terf2 UTSW 8 107076478 intron probably benign
R6414:Terf2 UTSW 8 107076854 missense probably benign 0.01
R6777:Terf2 UTSW 8 107070537 missense possibly damaging 0.95
R7315:Terf2 UTSW 8 107081217 missense probably benign 0.03
R8165:Terf2 UTSW 8 107083024 missense possibly damaging 0.83
R8396:Terf2 UTSW 8 107082981 critical splice donor site probably null
T0722:Terf2 UTSW 8 107076674 missense probably benign
Z1088:Terf2 UTSW 8 107081223 missense probably damaging 1.00
Z1177:Terf2 UTSW 8 107096295 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTGACAGTTACCATGCGTC -3'
(R):5'- GCTCAGAGTGTCACCCTATC -3'

Sequencing Primer
(F):5'- AACATCTGCAGGAGGGCTTACC -3'
(R):5'- TCAGAGTGTCACCCTATCTAAAAAC -3'
Posted On2019-10-07