Incidental Mutation 'R7481:Zfat'
ID579834
Institutional Source Beutler Lab
Gene Symbol Zfat
Ensembl Gene ENSMUSG00000022335
Gene Namezinc finger and AT hook domain containing
SynonymsLOC380993, Zfat1, Zfp406
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7481 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location68083764-68258856 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 68178866 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 769 (Q769*)
Ref Sequence ENSEMBL: ENSMUSP00000125257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]
Predicted Effect probably null
Transcript: ENSMUST00000160248
AA Change: Q769*
SMART Domains Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: Q769*

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1073 1082 N/A INTRINSIC
low complexity region 1139 1149 N/A INTRINSIC
low complexity region 1218 1236 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162054
AA Change: Q762*
SMART Domains Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: Q762*

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
ZnF_C2H2 319 342 2.36e-2 SMART
ZnF_C2H2 347 370 4.4e-2 SMART
ZnF_C2H2 397 419 1.67e-2 SMART
ZnF_C2H2 425 447 1.33e-1 SMART
ZnF_C2H2 451 474 2.05e-2 SMART
low complexity region 594 610 N/A INTRINSIC
ZnF_C2H2 730 752 1.43e-1 SMART
ZnF_C2H2 758 781 3.52e-1 SMART
ZnF_C2H2 786 810 5.59e-4 SMART
ZnF_C2H2 818 841 3.83e-2 SMART
ZnF_C2H2 868 891 3.95e1 SMART
ZnF_C2H2 897 919 6.88e-4 SMART
ZnF_C2H2 925 947 8.94e-3 SMART
ZnF_C2H2 954 976 2.27e-4 SMART
ZnF_C2H2 982 1005 9.3e-1 SMART
ZnF_C2H2 1029 1052 5.21e-4 SMART
low complexity region 1121 1131 N/A INTRINSIC
low complexity region 1200 1218 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162173
AA Change: Q769*
SMART Domains Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335
AA Change: Q769*

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1133 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,664,231 F68S unknown Het
Abcb6 A G 1: 75,173,604 F637L probably damaging Het
Aldh3b3 A G 19: 3,964,549 M95V probably benign Het
Arhgap45 A T 10: 80,022,300 H387L possibly damaging Het
Arntl2 G A 6: 146,818,871 A178T not run Het
Avil C T 10: 127,007,591 T130I probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C3 C A 17: 57,220,136 W771L probably damaging Het
C6 A G 15: 4,814,875 I926M Het
Cacna1b G A 2: 24,616,862 L1903F probably damaging Het
Car3 A T 3: 14,863,572 M1L probably benign Het
Ccdc175 A G 12: 72,155,624 I299T probably benign Het
Chd9 C T 8: 90,956,438 T502I unknown Het
Clec4a1 G A 6: 122,928,039 C99Y probably damaging Het
Col19a1 C T 1: 24,317,707 G632R probably damaging Het
Dmbt1 A T 7: 131,079,511 probably null Het
Dopey1 A T 9: 86,535,932 K1951N probably damaging Het
Dpf3 A C 12: 83,331,927 L122R probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Edem3 A T 1: 151,808,222 S687C probably damaging Het
Edem3 G A 1: 151,808,223 S687N possibly damaging Het
Fig4 A G 10: 41,230,005 probably null Het
Fmnl2 A G 2: 53,108,431 T603A unknown Het
Frmd6 T A 12: 70,887,055 L249Q probably damaging Het
Glrx3 T C 7: 137,445,022 C48R probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Gm6133 A T 18: 78,349,793 M1L probably benign Het
Gm9195 G A 14: 72,482,676 T105I probably benign Het
Hk2 G A 6: 82,760,169 T54I probably benign Het
Jade1 G A 3: 41,604,690 G402D probably benign Het
Kmt2a T C 9: 44,809,071 D3873G unknown Het
Map6 A T 7: 99,269,138 T373S possibly damaging Het
Megf9 T C 4: 70,433,442 T481A probably damaging Het
Mtus1 T A 8: 41,084,615 K21N probably damaging Het
Muc5b C T 7: 141,861,171 T2618I unknown Het
Nbas A G 12: 13,356,959 I852M probably damaging Het
Olfr1167 A G 2: 88,149,761 I86T probably benign Het
Olfr1242 C T 2: 89,494,292 V7I probably benign Het
Olfr125 T A 17: 37,835,398 M133K probably damaging Het
Olfr1480 A T 19: 13,530,453 Q304L probably damaging Het
Pank4 A G 4: 154,970,038 N156S probably damaging Het
Pcdhga8 A G 18: 37,727,937 E682G probably benign Het
Pde10a C A 17: 8,949,430 D312E possibly damaging Het
Pkhd1l1 A G 15: 44,512,911 T990A probably benign Het
Rab11fip1 T C 8: 27,156,581 T156A probably damaging Het
Rhbdd2 T A 5: 135,636,177 S121T possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Ryr3 C A 2: 112,678,093 R3418S probably benign Het
Ryr3 C A 2: 112,678,094 R3418M possibly damaging Het
Sbno2 G A 10: 80,057,499 P1323S probably benign Het
Sec24d T C 3: 123,350,763 C630R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Skp2 A T 15: 9,113,817 V371E probably damaging Het
Soga3 G T 10: 29,196,523 V604L probably damaging Het
Strbp A T 2: 37,600,754 S496R probably benign Het
Stxbp4 G A 11: 90,594,813 T236I possibly damaging Het
Terf2 C T 8: 107,072,721 probably null Het
Thnsl1 A T 2: 21,211,788 T118S probably benign Het
Tlnrd1 A T 7: 83,882,338 V295E probably damaging Het
Ttll6 A G 11: 96,154,846 T630A probably benign Het
Usp9y G T Y: 1,432,180 A435E probably benign Het
Vil1 A C 1: 74,419,899 R187S probably damaging Het
Vmn2r31 A T 7: 7,384,580 V664E possibly damaging Het
Wdr17 T C 8: 54,661,336 I693M probably benign Het
Wdr82 C T 9: 106,176,666 T72I probably damaging Het
Zbtb5 A G 4: 44,994,905 S160P probably benign Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Zglp1 C T 9: 21,062,607 S261N probably benign Het
Other mutations in Zfat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Zfat APN 15 68170222 missense possibly damaging 0.92
IGL00862:Zfat APN 15 68258663 splice site probably null
IGL01021:Zfat APN 15 68170166 missense possibly damaging 0.50
IGL01152:Zfat APN 15 68110504 missense probably damaging 1.00
IGL01733:Zfat APN 15 68180730 missense probably damaging 1.00
IGL01873:Zfat APN 15 68224895 missense probably benign 0.00
IGL01990:Zfat APN 15 68224817 missense probably damaging 1.00
IGL02066:Zfat APN 15 68180829 missense probably damaging 1.00
IGL02664:Zfat APN 15 68180721 missense probably damaging 1.00
IGL02955:Zfat APN 15 68181114 missense probably damaging 0.98
IGL03201:Zfat APN 15 68165909 missense probably damaging 1.00
R0145:Zfat UTSW 15 68187099 missense possibly damaging 0.95
R0408:Zfat UTSW 15 68180292 missense probably benign 0.10
R0633:Zfat UTSW 15 68180803 missense probably damaging 1.00
R1147:Zfat UTSW 15 68212583 splice site probably benign
R1508:Zfat UTSW 15 68178751 missense probably damaging 1.00
R1513:Zfat UTSW 15 68212680 missense probably damaging 1.00
R1641:Zfat UTSW 15 68180110 missense probably benign 0.19
R1889:Zfat UTSW 15 68101539 missense probably benign 0.00
R1959:Zfat UTSW 15 68146543 missense probably benign 0.32
R2030:Zfat UTSW 15 68118934 critical splice donor site probably null
R2202:Zfat UTSW 15 68179860 missense probably benign 0.36
R2340:Zfat UTSW 15 68101541 missense probably damaging 0.99
R3440:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68101581 missense probably damaging 0.99
R4406:Zfat UTSW 15 68180191 missense probably benign 0.00
R4649:Zfat UTSW 15 68184476 missense probably damaging 1.00
R4710:Zfat UTSW 15 68180282 missense probably benign
R4712:Zfat UTSW 15 68110475 critical splice donor site probably null
R4745:Zfat UTSW 15 68180374 missense probably benign 0.09
R4862:Zfat UTSW 15 68180110 missense probably benign 0.02
R5015:Zfat UTSW 15 68178913 missense probably damaging 1.00
R5075:Zfat UTSW 15 68180230 missense probably benign
R5208:Zfat UTSW 15 68180721 missense probably damaging 1.00
R5277:Zfat UTSW 15 68165909 missense probably damaging 1.00
R5303:Zfat UTSW 15 68110486 missense probably damaging 1.00
R5328:Zfat UTSW 15 68179828 missense probably damaging 0.99
R5642:Zfat UTSW 15 68180916 missense probably damaging 1.00
R5659:Zfat UTSW 15 68119013 missense probably damaging 1.00
R5947:Zfat UTSW 15 68179957 missense probably benign
R6046:Zfat UTSW 15 68180777 missense probably damaging 0.99
R6315:Zfat UTSW 15 68084462 missense probably damaging 1.00
R6342:Zfat UTSW 15 68180982 missense probably damaging 1.00
R6573:Zfat UTSW 15 68165854 missense probably damaging 1.00
R6789:Zfat UTSW 15 68084386 missense probably damaging 1.00
R7028:Zfat UTSW 15 68180452 missense probably damaging 1.00
R7033:Zfat UTSW 15 68181015 missense probably damaging 1.00
R7039:Zfat UTSW 15 68180362 missense probably benign
R7065:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7144:Zfat UTSW 15 68178782 missense probably benign 0.12
R7208:Zfat UTSW 15 68180007 missense probably benign 0.39
R7330:Zfat UTSW 15 68212751 missense probably benign 0.00
R7345:Zfat UTSW 15 68105043 missense probably damaging 1.00
R7378:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7405:Zfat UTSW 15 68184485 missense probably damaging 1.00
R7672:Zfat UTSW 15 68258686 start codon destroyed probably null 0.39
R7676:Zfat UTSW 15 68224844 missense possibly damaging 0.88
R7701:Zfat UTSW 15 68180908 nonsense probably null
R7825:Zfat UTSW 15 68179920 missense probably benign 0.01
R8152:Zfat UTSW 15 68101506 missense probably benign 0.23
Z1088:Zfat UTSW 15 68187101 missense probably benign 0.00
Z1177:Zfat UTSW 15 68179828 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCGGGCTTGCTACTTACCAG -3'
(R):5'- AATTTCCTGACAGAAATGTGGTGG -3'

Sequencing Primer
(F):5'- CCAGCTCTGTGTGAACTTTAAG -3'
(R):5'- CTGACAGAAATGTGGTGGAGAGTG -3'
Posted On2019-10-07