Incidental Mutation 'R7482:Stx17'
ID579847
Institutional Source Beutler Lab
Gene Symbol Stx17
Ensembl Gene ENSMUSG00000061455
Gene Namesyntaxin 17
Synonyms9030425C21Rik, 6330411F21Rik, 4833418L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7482 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48124915-48186507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48181722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 297 (D297G)
Ref Sequence ENSEMBL: ENSMUSP00000103348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064765] [ENSMUST00000107720] [ENSMUST00000107721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064765
AA Change: D297G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068087
Gene: ENSMUSG00000061455
AA Change: D297G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107720
AA Change: D297G

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103348
Gene: ENSMUSG00000061455
AA Change: D297G

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107721
SMART Domains Protein: ENSMUSP00000103349
Gene: ENSMUSG00000061455

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
t_SNARE 134 201 9.65e-13 SMART
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G A 13: 111,256,139 R336H probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ap2a2 C T 7: 141,602,297 P180S possibly damaging Het
Arfgef2 T C 2: 166,851,279 probably null Het
Arhgef25 A T 10: 127,185,671 M226K probably damaging Het
Brd7 T C 8: 88,361,626 D45G probably damaging Het
Bsn C A 9: 108,113,529 V1675F probably damaging Het
Chtf18 C A 17: 25,719,989 R820L possibly damaging Het
Cldn7 A G 11: 69,966,039 D38G possibly damaging Het
Clpb T C 7: 101,786,719 V615A possibly damaging Het
Cntnap4 T C 8: 112,733,562 probably null Het
Dchs2 T A 3: 83,248,725 S798T possibly damaging Het
Ect2l A T 10: 18,168,454 M311K probably benign Het
Gm6205 T C 5: 94,682,880 I79T possibly damaging Het
Hectd4 T A 5: 121,363,878 C4225S possibly damaging Het
Hecw2 T C 1: 54,040,470 H8R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Itgb2l T C 16: 96,426,833 E490G probably benign Het
Jakmip3 T A 7: 139,025,499 C411S possibly damaging Het
Klhl24 A G 16: 20,114,655 T339A possibly damaging Het
Mctp1 A T 13: 76,741,460 probably null Het
Mlf1 T A 3: 67,392,894 H81Q probably benign Het
Muc4 T A 16: 32,766,950 Y652N Het
Myo9b A G 8: 71,342,798 S804G probably benign Het
Olfr906 T G 9: 38,488,451 C141G probably damaging Het
Rab11fip5 T C 6: 85,340,778 E1043G probably benign Het
Radil A G 5: 142,486,763 V941A probably benign Het
Senp8 A G 9: 59,737,660 V71A probably damaging Het
Sh2d4a G A 8: 68,296,676 A121T probably benign Het
Tas2r105 A T 6: 131,687,009 M152K probably benign Het
Tlr11 G T 14: 50,362,999 C814F probably damaging Het
Tsc22d1 T C 14: 76,418,487 V802A probably benign Het
Vmn1r234 A G 17: 21,229,375 N184D probably benign Het
Vmn2r114 T C 17: 23,291,494 K671E probably damaging Het
Vmn2r27 A G 6: 124,224,261 F246L probably damaging Het
Xpo1 T G 11: 23,282,544 L355V probably benign Het
Other mutations in Stx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stx17 APN 4 48158955 missense possibly damaging 0.72
IGL01625:Stx17 APN 4 48181526 missense probably damaging 1.00
IGL01975:Stx17 APN 4 48180670 missense probably damaging 1.00
R1977:Stx17 UTSW 4 48181553 missense probably benign 0.00
R2069:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4117:Stx17 UTSW 4 48180689 missense probably damaging 1.00
R4201:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4202:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R5265:Stx17 UTSW 4 48183470 utr 3 prime probably benign
R5308:Stx17 UTSW 4 48182851 utr 3 prime probably benign
R6414:Stx17 UTSW 4 48158809 critical splice acceptor site probably null
R6499:Stx17 UTSW 4 48183478 critical splice donor site probably null
R6969:Stx17 UTSW 4 48140462 missense probably damaging 1.00
R7062:Stx17 UTSW 4 48140442 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACTCATCGGAGGAGTGGTAG -3'
(R):5'- GCTCTTTGGCAGTCTTTAAACTTG -3'

Sequencing Primer
(F):5'- AGGAGTGGTAGGGGGTCCC -3'
(R):5'- GGCAGTCTTTAAACTTGACCTGACAG -3'
Posted On2019-10-07