Incidental Mutation 'R7482:Hif3a'
ID579855
Institutional Source Beutler Lab
Gene Symbol Hif3a
Ensembl Gene ENSMUSG00000004328
Gene Namehypoxia inducible factor 3, alpha subunit
SynonymsMOP7, Nepas, bHLHe17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R7482 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location17031507-17062427 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17042635 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 462 (T462I)
Ref Sequence ENSEMBL: ENSMUSP00000104132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037762] [ENSMUST00000108492]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037762
AA Change: T460I

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048248
Gene: ENSMUSG00000004328
AA Change: T460I

DomainStartEndE-ValueType
HLH 18 73 1.57e-7 SMART
PAS 82 148 9.83e-10 SMART
PAS 225 293 2.72e-3 SMART
PAC 299 342 2.18e-2 SMART
low complexity region 421 437 N/A INTRINSIC
Pfam:HIF-1 472 505 1.8e-18 PFAM
low complexity region 508 520 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108492
AA Change: T462I

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104132
Gene: ENSMUSG00000004328
AA Change: T462I

DomainStartEndE-ValueType
HLH 20 75 1.57e-7 SMART
PAS 84 150 9.83e-10 SMART
PAS 227 295 2.72e-3 SMART
PAC 301 344 2.18e-2 SMART
low complexity region 423 439 N/A INTRINSIC
Pfam:HIF-1 475 506 5.7e-18 PFAM
low complexity region 510 522 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha-3 subunit of one of several alpha/beta-subunit heterodimeric transcription factors that regulate many adaptive responses to low oxygen tension (hypoxia). The alpha-3 subunit lacks the transactivation domain found in factors containing either the alpha-1 or alpha-2 subunits. It is thought that factors containing the alpha-3 subunit are negative regulators of hypoxia-inducible gene expression. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired lung remodeling resulting in hypertrophy of the heart right ventricle and pulmonary hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G A 13: 111,256,139 R336H probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ap2a2 C T 7: 141,602,297 P180S possibly damaging Het
Arfgef2 T C 2: 166,851,279 probably null Het
Arhgef25 A T 10: 127,185,671 M226K probably damaging Het
Brd7 T C 8: 88,361,626 D45G probably damaging Het
Bsn C A 9: 108,113,529 V1675F probably damaging Het
Chtf18 C A 17: 25,719,989 R820L possibly damaging Het
Cldn7 A G 11: 69,966,039 D38G possibly damaging Het
Clpb T C 7: 101,786,719 V615A possibly damaging Het
Cntnap4 T C 8: 112,733,562 probably null Het
Dchs2 T A 3: 83,248,725 S798T possibly damaging Het
Ect2l A T 10: 18,168,454 M311K probably benign Het
Gm6205 T C 5: 94,682,880 I79T possibly damaging Het
Hectd4 T A 5: 121,363,878 C4225S possibly damaging Het
Hecw2 T C 1: 54,040,470 H8R probably damaging Het
Itgb2l T C 16: 96,426,833 E490G probably benign Het
Jakmip3 T A 7: 139,025,499 C411S possibly damaging Het
Klhl24 A G 16: 20,114,655 T339A possibly damaging Het
Mlf1 T A 3: 67,392,894 H81Q probably benign Het
Muc4 T A 16: 32,766,950 Y652N Het
Myo9b A G 8: 71,342,798 S804G probably benign Het
Olfr906 T G 9: 38,488,451 C141G probably damaging Het
Rab11fip5 T C 6: 85,340,778 E1043G probably benign Het
Radil A G 5: 142,486,763 V941A probably benign Het
Senp8 A G 9: 59,737,660 V71A probably damaging Het
Sh2d4a G A 8: 68,296,676 A121T probably benign Het
Stx17 A G 4: 48,181,722 D297G possibly damaging Het
Tas2r105 A T 6: 131,687,009 M152K probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tlr11 G T 14: 50,362,999 C814F probably damaging Het
Tsc22d1 T C 14: 76,418,487 V802A probably benign Het
Vmn1r234 A G 17: 21,229,375 N184D probably benign Het
Vmn2r114 T C 17: 23,291,494 K671E probably damaging Het
Vmn2r27 A G 6: 124,224,261 F246L probably damaging Het
Xpo1 T G 11: 23,282,544 L355V probably benign Het
Other mutations in Hif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Hif3a APN 7 17051916 splice site probably null
IGL02496:Hif3a APN 7 17039678 splice site probably benign
IGL02572:Hif3a APN 7 17050588 missense probably null
IGL02638:Hif3a APN 7 17044368 unclassified probably benign
IGL02704:Hif3a APN 7 17050761 unclassified probably benign
IGL03000:Hif3a APN 7 17048639 missense probably benign 0.08
IGL03342:Hif3a APN 7 17041122 missense possibly damaging 0.92
R0265:Hif3a UTSW 7 17035868 makesense probably null
R0326:Hif3a UTSW 7 17044400 missense probably benign 0.01
R0396:Hif3a UTSW 7 17052021 splice site probably benign
R1494:Hif3a UTSW 7 17054722 missense probably damaging 1.00
R1529:Hif3a UTSW 7 17042639 missense probably benign 0.02
R1548:Hif3a UTSW 7 17044403 missense probably benign 0.00
R1686:Hif3a UTSW 7 17044864 missense possibly damaging 0.46
R1916:Hif3a UTSW 7 17039656 missense possibly damaging 0.87
R2026:Hif3a UTSW 7 17044397 missense possibly damaging 0.81
R2032:Hif3a UTSW 7 17051179 missense probably damaging 1.00
R2354:Hif3a UTSW 7 17041105 missense probably damaging 1.00
R3693:Hif3a UTSW 7 17041074 missense probably damaging 1.00
R3780:Hif3a UTSW 7 17054713 missense probably damaging 1.00
R3921:Hif3a UTSW 7 17037172 missense possibly damaging 0.80
R4003:Hif3a UTSW 7 17044919 missense probably damaging 0.99
R4714:Hif3a UTSW 7 17056271 missense probably damaging 1.00
R4953:Hif3a UTSW 7 17050565 missense probably damaging 0.98
R5632:Hif3a UTSW 7 17050655 missense possibly damaging 0.94
R5778:Hif3a UTSW 7 17051984 missense probably damaging 1.00
R5877:Hif3a UTSW 7 17051146 missense probably damaging 1.00
R5995:Hif3a UTSW 7 17053769 missense probably benign 0.10
R6001:Hif3a UTSW 7 17050561 missense probably damaging 1.00
R6599:Hif3a UTSW 7 17042605 missense possibly damaging 0.68
R7218:Hif3a UTSW 7 17050588 missense probably damaging 1.00
R7478:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7479:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7480:Hif3a UTSW 7 17042635 missense possibly damaging 0.47
R7654:Hif3a UTSW 7 17049096 missense probably damaging 0.97
R7696:Hif3a UTSW 7 17054787 missense unknown
Predicted Primers PCR Primer
(F):5'- GCCAATGAAACCATGGTCTACT -3'
(R):5'- TGCATTGCTGTTTGACCTCTTGT -3'

Sequencing Primer
(F):5'- CACACATATCTATCTAATCTGTCACC -3'
(R):5'- TGTAATCTTCAGCCTAAGACCC -3'
Posted On2019-10-07