Incidental Mutation 'R7482:Jakmip3'
ID579857
Institutional Source Beutler Lab
Gene Symbol Jakmip3
Ensembl Gene ENSMUSG00000056856
Gene Namejanus kinase and microtubule interacting protein 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7482 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location138940730-139083976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139025499 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 411 (C411S)
Ref Sequence ENSEMBL: ENSMUSP00000148120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106111] [ENSMUST00000166163] [ENSMUST00000209297]
Predicted Effect unknown
Transcript: ENSMUST00000106111
AA Change: C411S
SMART Domains Protein: ENSMUSP00000101717
Gene: ENSMUSG00000056856
AA Change: C411S

DomainStartEndE-ValueType
coiled coil region 9 349 N/A INTRINSIC
coiled coil region 421 452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166163
AA Change: C483S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130207
Gene: ENSMUSG00000056856
AA Change: C483S

DomainStartEndE-ValueType
coiled coil region 9 255 N/A INTRINSIC
low complexity region 270 282 N/A INTRINSIC
coiled coil region 289 421 N/A INTRINSIC
coiled coil region 493 524 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209297
AA Change: C411S

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G A 13: 111,256,139 R336H probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ap2a2 C T 7: 141,602,297 P180S possibly damaging Het
Arfgef2 T C 2: 166,851,279 probably null Het
Arhgef25 A T 10: 127,185,671 M226K probably damaging Het
Brd7 T C 8: 88,361,626 D45G probably damaging Het
Bsn C A 9: 108,113,529 V1675F probably damaging Het
Chtf18 C A 17: 25,719,989 R820L possibly damaging Het
Cldn7 A G 11: 69,966,039 D38G possibly damaging Het
Clpb T C 7: 101,786,719 V615A possibly damaging Het
Cntnap4 T C 8: 112,733,562 probably null Het
Dchs2 T A 3: 83,248,725 S798T possibly damaging Het
Ect2l A T 10: 18,168,454 M311K probably benign Het
Gm6205 T C 5: 94,682,880 I79T possibly damaging Het
Hectd4 T A 5: 121,363,878 C4225S possibly damaging Het
Hecw2 T C 1: 54,040,470 H8R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Itgb2l T C 16: 96,426,833 E490G probably benign Het
Klhl24 A G 16: 20,114,655 T339A possibly damaging Het
Mctp1 A T 13: 76,741,460 probably null Het
Mlf1 T A 3: 67,392,894 H81Q probably benign Het
Muc4 T A 16: 32,766,950 Y652N Het
Myo9b A G 8: 71,342,798 S804G probably benign Het
Olfr906 T G 9: 38,488,451 C141G probably damaging Het
Rab11fip5 T C 6: 85,340,778 E1043G probably benign Het
Radil A G 5: 142,486,763 V941A probably benign Het
Senp8 A G 9: 59,737,660 V71A probably damaging Het
Sh2d4a G A 8: 68,296,676 A121T probably benign Het
Stx17 A G 4: 48,181,722 D297G possibly damaging Het
Tas2r105 A T 6: 131,687,009 M152K probably benign Het
Tlr11 G T 14: 50,362,999 C814F probably damaging Het
Tsc22d1 T C 14: 76,418,487 V802A probably benign Het
Vmn1r234 A G 17: 21,229,375 N184D probably benign Het
Vmn2r114 T C 17: 23,291,494 K671E probably damaging Het
Vmn2r27 A G 6: 124,224,261 F246L probably damaging Het
Xpo1 T G 11: 23,282,544 L355V probably benign Het
Other mutations in Jakmip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Jakmip3 APN 7 139017573 missense possibly damaging 0.71
IGL01095:Jakmip3 APN 7 139020817 missense probably damaging 1.00
IGL01356:Jakmip3 APN 7 139017612 missense probably damaging 0.99
IGL01718:Jakmip3 APN 7 138989392 missense possibly damaging 0.94
IGL01759:Jakmip3 APN 7 139020904 missense probably damaging 0.97
IGL02149:Jakmip3 APN 7 139007346 missense possibly damaging 0.57
IGL02152:Jakmip3 APN 7 139025488 missense probably damaging 1.00
IGL02691:Jakmip3 APN 7 139026844 nonsense probably null
R1175:Jakmip3 UTSW 7 139027786 missense probably damaging 1.00
R1439:Jakmip3 UTSW 7 139029646 missense probably benign 0.00
R1509:Jakmip3 UTSW 7 139027776 missense possibly damaging 0.94
R1868:Jakmip3 UTSW 7 139007587 missense probably benign 0.04
R1938:Jakmip3 UTSW 7 139020138 missense probably damaging 0.97
R2566:Jakmip3 UTSW 7 138989468 missense possibly damaging 0.88
R3418:Jakmip3 UTSW 7 139017745 intron probably benign
R4825:Jakmip3 UTSW 7 139026766 missense probably damaging 1.00
R5011:Jakmip3 UTSW 7 139020222 missense probably damaging 1.00
R5327:Jakmip3 UTSW 7 139025435 missense possibly damaging 0.54
R5519:Jakmip3 UTSW 7 139007791 missense probably damaging 1.00
R6291:Jakmip3 UTSW 7 139020856 missense probably damaging 1.00
R6393:Jakmip3 UTSW 7 139019171 missense probably damaging 1.00
R6960:Jakmip3 UTSW 7 139023336 missense probably damaging 1.00
R7116:Jakmip3 UTSW 7 139020250 missense possibly damaging 0.87
R7191:Jakmip3 UTSW 7 138989528 splice site probably null
R7232:Jakmip3 UTSW 7 139007626 missense probably benign 0.00
R7385:Jakmip3 UTSW 7 139023339 missense possibly damaging 0.55
R7657:Jakmip3 UTSW 7 139019174 missense probably damaging 1.00
R7814:Jakmip3 UTSW 7 139019129 missense probably damaging 1.00
R8321:Jakmip3 UTSW 7 139026884 missense probably benign
R8886:Jakmip3 UTSW 7 139007442 missense probably benign 0.01
Z1176:Jakmip3 UTSW 7 139020133 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCAGCTGAGACCTCACTC -3'
(R):5'- TTGTCACTGTGCAGAGGAGAG -3'

Sequencing Primer
(F):5'- TCACTCCCGGGCAACAG -3'
(R):5'- CACTGTGCAGAGGAGAGGACTG -3'
Posted On2019-10-07