Incidental Mutation 'R7482:Brd7'
ID579862
Institutional Source Beutler Lab
Gene Symbol Brd7
Ensembl Gene ENSMUSG00000031660
Gene Namebromodomain containing 7
Synonymsbromodomain protein 75 kDa, CELTIX1, BP75
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #R7482 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location88331039-88362194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88361626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000034085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034085]
Predicted Effect probably damaging
Transcript: ENSMUST00000034085
AA Change: D45G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034085
Gene: ENSMUSG00000031660
AA Change: D45G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
low complexity region 76 96 N/A INTRINSIC
BROMO 129 237 9.72e-38 SMART
Pfam:DUF3512 287 534 2.4e-93 PFAM
coiled coil region 535 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the bromodomain-containing protein family. The product of this gene has been identified as a component of one form of the SWI/SNF chromatin remodeling complex, and as a protein which interacts with p53 and is required for p53-dependent oncogene-induced senescence which prevents tumor growth. Pseudogenes have been described on chromosomes 2, 3, 6, 13 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cognitive behavior and dendrite morphology in the medial prefrontal cortex. Mice homozygous for a different knock-out allele die in utero prior to E16.5, showing fetal growth retardation and altered limb, blood vessel and organ development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G A 13: 111,256,139 R336H probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ap2a2 C T 7: 141,602,297 P180S possibly damaging Het
Arfgef2 T C 2: 166,851,279 probably null Het
Arhgef25 A T 10: 127,185,671 M226K probably damaging Het
Bsn C A 9: 108,113,529 V1675F probably damaging Het
Chtf18 C A 17: 25,719,989 R820L possibly damaging Het
Cldn7 A G 11: 69,966,039 D38G possibly damaging Het
Clpb T C 7: 101,786,719 V615A possibly damaging Het
Cntnap4 T C 8: 112,733,562 probably null Het
Dchs2 T A 3: 83,248,725 S798T possibly damaging Het
Ect2l A T 10: 18,168,454 M311K probably benign Het
Gm6205 T C 5: 94,682,880 I79T possibly damaging Het
Hectd4 T A 5: 121,363,878 C4225S possibly damaging Het
Hecw2 T C 1: 54,040,470 H8R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Itgb2l T C 16: 96,426,833 E490G probably benign Het
Jakmip3 T A 7: 139,025,499 C411S possibly damaging Het
Klhl24 A G 16: 20,114,655 T339A possibly damaging Het
Mctp1 A T 13: 76,741,460 probably null Het
Mlf1 T A 3: 67,392,894 H81Q probably benign Het
Muc4 T A 16: 32,766,950 Y652N Het
Myo9b A G 8: 71,342,798 S804G probably benign Het
Olfr906 T G 9: 38,488,451 C141G probably damaging Het
Rab11fip5 T C 6: 85,340,778 E1043G probably benign Het
Radil A G 5: 142,486,763 V941A probably benign Het
Senp8 A G 9: 59,737,660 V71A probably damaging Het
Sh2d4a G A 8: 68,296,676 A121T probably benign Het
Stx17 A G 4: 48,181,722 D297G possibly damaging Het
Tas2r105 A T 6: 131,687,009 M152K probably benign Het
Tlr11 G T 14: 50,362,999 C814F probably damaging Het
Tsc22d1 T C 14: 76,418,487 V802A probably benign Het
Vmn1r234 A G 17: 21,229,375 N184D probably benign Het
Vmn2r114 T C 17: 23,291,494 K671E probably damaging Het
Vmn2r27 A G 6: 124,224,261 F246L probably damaging Het
Xpo1 T G 11: 23,282,544 L355V probably benign Het
Other mutations in Brd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Brd7 APN 8 88332875 unclassified probably benign
IGL02172:Brd7 APN 8 88351824 missense probably benign 0.41
IGL02441:Brd7 APN 8 88343590 missense probably damaging 1.00
R0241:Brd7 UTSW 8 88345850 missense probably benign 0.01
R0241:Brd7 UTSW 8 88345850 missense probably benign 0.01
R0845:Brd7 UTSW 8 88342767 nonsense probably null
R1613:Brd7 UTSW 8 88346950 missense probably benign 0.00
R1659:Brd7 UTSW 8 88333792 missense probably damaging 1.00
R1663:Brd7 UTSW 8 88358023 missense possibly damaging 0.87
R2237:Brd7 UTSW 8 88346913 missense probably benign 0.22
R2280:Brd7 UTSW 8 88342757 missense probably benign 0.00
R2916:Brd7 UTSW 8 88342780 missense probably damaging 0.98
R2917:Brd7 UTSW 8 88342780 missense probably damaging 0.98
R3770:Brd7 UTSW 8 88339407 critical splice donor site probably null
R4030:Brd7 UTSW 8 88332931 missense probably damaging 1.00
R5287:Brd7 UTSW 8 88357541 missense probably damaging 1.00
R5403:Brd7 UTSW 8 88357541 missense probably damaging 1.00
R6333:Brd7 UTSW 8 88345191 missense probably damaging 1.00
R7021:Brd7 UTSW 8 88347004 missense probably benign 0.00
R7072:Brd7 UTSW 8 88346987 missense probably benign
R7445:Brd7 UTSW 8 88361708 missense probably damaging 1.00
X0067:Brd7 UTSW 8 88343697 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTTCTGGTCTGTCTCAC -3'
(R):5'- ACTTCTACGAGGGTGAGGAG -3'

Sequencing Primer
(F):5'- CAGACTTCCCAGACGTCTG -3'
(R):5'- TTCGACTCGGGCCTGCC -3'
Posted On2019-10-07