Mutagenetix > Incidental Mutations

Incidental Mutation 'R7482:Xpo1'

579869

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7482 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 23282544 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 355 (L355V)

Ref Sequence

ENSEMBL: ENSMUSP00000105178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]

AlphaFold

Q6P5F9

PDB Structure

Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000020538
AA Change: L355V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: L355V

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102869
AA Change: L355V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: L355V

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102870
AA Change: L355V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: L355V

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109551
AA Change: L355V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: L355V

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150750

SMART Domains

Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
Blast:CRM1_C	97	136	3e-8	BLAST
Pfam:CRM1_C	171	233	4.3e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actbl2	G	A	13: 111,256,139	R336H	probably damaging	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Ap2a2	C	T	7: 141,602,297	P180S	possibly damaging	Het
Arfgef2	T	C	2: 166,851,279		probably null	Het
Arhgef25	A	T	10: 127,185,671	M226K	probably damaging	Het
Brd7	T	C	8: 88,361,626	D45G	probably damaging	Het
Bsn	C	A	9: 108,113,529	V1675F	probably damaging	Het
Chtf18	C	A	17: 25,719,989	R820L	possibly damaging	Het
Cldn7	A	G	11: 69,966,039	D38G	possibly damaging	Het
Clpb	T	C	7: 101,786,719	V615A	possibly damaging	Het
Cntnap4	T	C	8: 112,733,562		probably null	Het
Dchs2	T	A	3: 83,248,725	S798T	possibly damaging	Het
Ect2l	A	T	10: 18,168,454	M311K	probably benign	Het
Gm6205	T	C	5: 94,682,880	I79T	possibly damaging	Het
Hectd4	T	A	5: 121,363,878	C4225S	possibly damaging	Het
Hecw2	T	C	1: 54,040,470	H8R	probably damaging	Het
Hif3a	G	A	7: 17,042,635	T462I	possibly damaging	Het
Itgb2l	T	C	16: 96,426,833	E490G	probably benign	Het
Jakmip3	T	A	7: 139,025,499	C411S	possibly damaging	Het
Klhl24	A	G	16: 20,114,655	T339A	possibly damaging	Het
Mctp1	A	T	13: 76,741,460		probably null	Het
Mlf1	T	A	3: 67,392,894	H81Q	probably benign	Het
Muc4	T	A	16: 32,766,950	Y652N		Het
Myo9b	A	G	8: 71,342,798	S804G	probably benign	Het
Olfr906	T	G	9: 38,488,451	C141G	probably damaging	Het
Rab11fip5	T	C	6: 85,340,778	E1043G	probably benign	Het
Radil	A	G	5: 142,486,763	V941A	probably benign	Het
Senp8	A	G	9: 59,737,660	V71A	probably damaging	Het
Sh2d4a	G	A	8: 68,296,676	A121T	probably benign	Het
Stx17	A	G	4: 48,181,722	D297G	possibly damaging	Het
Tas2r105	A	T	6: 131,687,009	M152K	probably benign	Het
Tlr11	G	T	14: 50,362,999	C814F	probably damaging	Het
Tsc22d1	T	C	14: 76,418,487	V802A	probably benign	Het
Vmn1r234	A	G	17: 21,229,375	N184D	probably benign	Het
Vmn2r114	T	C	17: 23,291,494	K671E	probably damaging	Het
Vmn2r27	A	G	6: 124,224,261	F246L	probably damaging	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R0742:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R1385:Xpo1	UTSW	11	23261863	missense	probably damaging	0.96
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6591:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8335:Xpo1	UTSW	11	23280603	splice site	probably null
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9232:Xpo1	UTSW	11	23282646	missense	probably benign
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAATATCTGCTGCCCGTTTTCAG -3'
(R):5'- GTCAAGTACAGCTGTCTCCTAGG -3'

Sequencing Primer
(F):5'- TAAGAGATCCACCTGGCTCTTGG -3'
(R):5'- GGAGGAATATCAAAGTGTTGACTTCC -3'

Posted On

2019-10-07