Incidental Mutation 'R7482:Vmn1r234'
ID579877
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7482 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21229375 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 184 (N184D)
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably benign
Transcript: ENSMUST00000079633
AA Change: N184D

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203
AA Change: N184D

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 G A 13: 111,256,139 R336H probably damaging Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Ap2a2 C T 7: 141,602,297 P180S possibly damaging Het
Arfgef2 T C 2: 166,851,279 probably null Het
Arhgef25 A T 10: 127,185,671 M226K probably damaging Het
Brd7 T C 8: 88,361,626 D45G probably damaging Het
Bsn C A 9: 108,113,529 V1675F probably damaging Het
Chtf18 C A 17: 25,719,989 R820L possibly damaging Het
Cldn7 A G 11: 69,966,039 D38G possibly damaging Het
Clpb T C 7: 101,786,719 V615A possibly damaging Het
Cntnap4 T C 8: 112,733,562 probably null Het
Dchs2 T A 3: 83,248,725 S798T possibly damaging Het
Ect2l A T 10: 18,168,454 M311K probably benign Het
Gm6205 T C 5: 94,682,880 I79T possibly damaging Het
Hectd4 T A 5: 121,363,878 C4225S possibly damaging Het
Hecw2 T C 1: 54,040,470 H8R probably damaging Het
Hif3a G A 7: 17,042,635 T462I possibly damaging Het
Itgb2l T C 16: 96,426,833 E490G probably benign Het
Jakmip3 T A 7: 139,025,499 C411S possibly damaging Het
Klhl24 A G 16: 20,114,655 T339A possibly damaging Het
Mctp1 A T 13: 76,741,460 probably null Het
Mlf1 T A 3: 67,392,894 H81Q probably benign Het
Muc4 T A 16: 32,766,950 Y652N Het
Myo9b A G 8: 71,342,798 S804G probably benign Het
Olfr906 T G 9: 38,488,451 C141G probably damaging Het
Rab11fip5 T C 6: 85,340,778 E1043G probably benign Het
Radil A G 5: 142,486,763 V941A probably benign Het
Senp8 A G 9: 59,737,660 V71A probably damaging Het
Sh2d4a G A 8: 68,296,676 A121T probably benign Het
Stx17 A G 4: 48,181,722 D297G possibly damaging Het
Tas2r105 A T 6: 131,687,009 M152K probably benign Het
Tlr11 G T 14: 50,362,999 C814F probably damaging Het
Tsc22d1 T C 14: 76,418,487 V802A probably benign Het
Vmn2r114 T C 17: 23,291,494 K671E probably damaging Het
Vmn2r27 A G 6: 124,224,261 F246L probably damaging Het
Xpo1 T G 11: 23,282,544 L355V probably benign Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
R8295:Vmn1r234 UTSW 17 21228839 missense probably benign 0.01
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAGTGCATGCTTATTGAGTGTC -3'
(R):5'- TGGACTCATGGCTGGATCTAG -3'

Sequencing Primer
(F):5'- GAGTGTCTTCCAGGTCATCAC -3'
(R):5'- GCTGGATCTAGGGAAAATATTGCTCC -3'
Posted On2019-10-07