Incidental Mutation 'R7483:Zfp687'
ID579892
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R7483 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95007530 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1220 (R1220H)
Ref Sequence ENSEMBL: ENSMUSP00000019482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000072287] [ENSMUST00000107251] [ENSMUST00000125476] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000133297] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000167008]
Predicted Effect probably damaging
Transcript: ENSMUST00000019482
AA Change: R1220H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338
AA Change: R1220H

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072287
SMART Domains Protein: ENSMUSP00000072134
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 545 799 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107251
SMART Domains Protein: ENSMUSP00000102872
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
SCOP:d1e8xa1 140 231 5e-22 SMART
PI3Kc 560 814 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125476
SMART Domains Protein: ENSMUSP00000121965
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
low complexity region 22 43 N/A INTRINSIC
SCOP:d1e8xa1 152 243 5e-22 SMART
PI3Kc 572 826 6.47e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133297
SMART Domains Protein: ENSMUSP00000123529
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 1 225 7.13e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137799
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167008
SMART Domains Protein: ENSMUSP00000132150
Gene: ENSMUSG00000038861

DomainStartEndE-ValueType
PI3Kc 228 482 6.47e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,656,012 probably null Het
Ahnak T C 19: 9,004,822 S1157P probably damaging Het
Akap12 T G 10: 4,353,967 V364G probably benign Het
Ankrd17 A G 5: 90,299,996 S229P probably benign Het
Apof A T 10: 128,268,767 Y5F probably benign Het
Arhgap24 T A 5: 102,841,308 M94K probably benign Het
Ash2l G T 8: 25,822,770 D479E probably damaging Het
Atp8a2 A T 14: 60,008,375 C623S probably benign Het
Bmper T A 9: 23,483,942 N656K probably benign Het
Braf T C 6: 39,627,838 I619V possibly damaging Het
Brwd1 T C 16: 96,056,173 R396G probably damaging Het
Car7 A T 8: 104,549,584 T234S probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cemip T G 7: 83,998,576 I99L probably damaging Het
Chrna7 C A 7: 63,104,990 V290L probably damaging Het
Clip1 A T 5: 123,617,384 D944E probably benign Het
Cyp2c68 T C 19: 39,689,137 T470A probably benign Het
Dmbx1 G T 4: 115,923,711 A31D probably damaging Het
Dnah7b T C 1: 46,175,419 F1115L probably damaging Het
Dock10 T C 1: 80,515,566 I1897V probably benign Het
Efcab3 A G 11: 105,109,286 I234V probably benign Het
Eid2b T G 7: 28,277,818 L13R probably damaging Het
Enam A G 5: 88,501,820 Y396C probably damaging Het
Fam161a A T 11: 23,021,006 T395S probably damaging Het
Fat1 A G 8: 45,023,160 R1748G probably benign Het
Fdxacb1 C A 9: 50,770,151 T124K possibly damaging Het
Fer1l6 A T 15: 58,641,945 D1563V possibly damaging Het
Gm20834 T C Y: 10,323,226 H70R probably damaging Het
Gucy2d T A 7: 98,449,757 M261K probably damaging Het
Hcar2 T A 5: 123,864,798 Q214L probably benign Het
Hdac11 C T 6: 91,159,232 H75Y probably damaging Het
Hoxa2 C A 6: 52,164,299 A116S probably benign Het
Ints2 A G 11: 86,215,618 C989R probably damaging Het
Jpt1 T C 11: 115,503,124 E36G probably damaging Het
Kdm5d G A Y: 914,044 R327Q possibly damaging Het
Klhl1 T C 14: 96,346,868 M309V probably benign Het
Larp4 A G 15: 99,991,778 K193E probably benign Het
Lmo3 C T 6: 138,416,502 C40Y probably damaging Het
Mcm4 A G 16: 15,630,442 V417A probably benign Het
Med8 A G 4: 118,410,979 E34G probably damaging Het
Mex3b G T 7: 82,867,906 A86S possibly damaging Het
Muc6 T C 7: 141,639,823 T1646A unknown Het
Myo15b A T 11: 115,858,744 E113D Het
Myo7a T A 7: 98,063,674 H1698L probably benign Het
Myocos T A 1: 162,657,109 M44L unknown Het
Nalcn A G 14: 123,314,087 V1036A probably damaging Het
Nfrkb C T 9: 31,414,032 Q924* probably null Het
Nol6 A G 4: 41,117,424 L923P possibly damaging Het
Nrxn3 T C 12: 89,510,462 Y472H probably damaging Het
Nudcd1 A G 15: 44,405,857 Y136H possibly damaging Het
Obox2 T C 7: 15,397,316 C116R probably damaging Het
Olfr1309 T C 2: 111,983,779 I98M probably damaging Het
Olfr1333 A G 4: 118,830,320 V39A probably damaging Het
Olfr715b T A 7: 107,106,775 I29F probably benign Het
Olfr743 T A 14: 50,534,015 V201D probably benign Het
Onecut3 A T 10: 80,495,476 S157C unknown Het
Oscp1 C T 4: 126,073,933 R91* probably null Het
Pclo A T 5: 14,712,592 D408V Het
Pde8a T C 7: 81,282,833 V81A probably benign Het
Pde8b T A 13: 95,027,743 D653V probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pik3cg T C 12: 32,195,648 Y867C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Psd4 A T 2: 24,404,756 D776V possibly damaging Het
Ptprb A G 10: 116,283,429 E156G probably benign Het
Rad54b A G 4: 11,610,372 Y663C probably damaging Het
Ranbp3l T A 15: 9,002,132 V78D possibly damaging Het
Rbm12 T C 2: 156,098,218 I45V unknown Het
Rsg1 A G 4: 141,219,842 D178G probably damaging Het
Scn9a A G 2: 66,533,348 V862A probably damaging Het
Sdcbp T C 4: 6,393,089 I242T possibly damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc45a3 G T 1: 131,976,811 probably benign Het
Srpk1 T C 17: 28,594,218 I517M probably benign Het
Tmx4 A G 2: 134,639,661 M114T probably benign Het
Trhr T A 15: 44,229,231 V288D probably damaging Het
Tspoap1 A T 11: 87,761,525 I42F probably benign Het
Ttn A T 2: 76,951,512 D1063E unknown Het
Tusc3 A G 8: 39,071,481 I225V probably benign Het
Ugt2b38 A G 5: 87,424,114 S20P probably damaging Het
Upf2 A G 2: 6,027,408 T922A unknown Het
Usp38 C T 8: 81,014,561 probably benign Het
Vmn1r216 A G 13: 23,099,568 I140M probably damaging Het
Vmn2r115 T A 17: 23,346,397 N419K possibly damaging Het
Vmn2r55 C T 7: 12,670,828 G216D probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt7b C A 15: 85,537,414 R349L possibly damaging Het
Xbp1 T C 11: 5,521,098 V35A probably benign Het
Zan A T 5: 137,446,795 M1734K unknown Het
Zfhx4 A G 3: 5,412,177 E3284G probably damaging Het
Zfp458 A G 13: 67,256,914 L487S possibly damaging Het
Zp1 A G 19: 10,917,916 L324P possibly damaging Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4630:Zfp687 UTSW 3 95012488 splice site probably null
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
R7407:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7408:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7492:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7514:Zfp687 UTSW 3 95007530 missense probably damaging 1.00
R7849:Zfp687 UTSW 3 95010362 missense possibly damaging 0.65
R8438:Zfp687 UTSW 3 95008122 missense probably benign 0.10
Z1176:Zfp687 UTSW 3 95007701 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGTGCAAGTCACTAGAATCC -3'
(R):5'- CGGTTCATTAGCCACAAGAAGAG -3'

Sequencing Primer
(F):5'- GTGCAAGTCACTAGAATCCTCAAAAG -3'
(R):5'- TTCATTAGCCACAAGAAGAGACGGG -3'
Posted On2019-10-07