Incidental Mutation 'R7483:Pkd1l3'
ID579933
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Namepolycystic kidney disease 1 like 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7483 (G1)
Quality Score214.458
Status Not validated
Chromosome8
Chromosomal Location109614517-109674386 bp(+) (GRCm38)
Type of Mutationsmall deletion (13 aa in frame mutation)
DNA Base Change (assembly) GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA at 109624195 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
Predicted Effect probably benign
Transcript: ENSMUST00000057344
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109242
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212537
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,656,012 probably null Het
Ahnak T C 19: 9,004,822 S1157P probably damaging Het
Akap12 T G 10: 4,353,967 V364G probably benign Het
Ankrd17 A G 5: 90,299,996 S229P probably benign Het
Apof A T 10: 128,268,767 Y5F probably benign Het
Arhgap24 T A 5: 102,841,308 M94K probably benign Het
Ash2l G T 8: 25,822,770 D479E probably damaging Het
Atp8a2 A T 14: 60,008,375 C623S probably benign Het
Bmper T A 9: 23,483,942 N656K probably benign Het
Braf T C 6: 39,627,838 I619V possibly damaging Het
Brwd1 T C 16: 96,056,173 R396G probably damaging Het
Car7 A T 8: 104,549,584 T234S probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cemip T G 7: 83,998,576 I99L probably damaging Het
Chrna7 C A 7: 63,104,990 V290L probably damaging Het
Clip1 A T 5: 123,617,384 D944E probably benign Het
Cyp2c68 T C 19: 39,689,137 T470A probably benign Het
Dmbx1 G T 4: 115,923,711 A31D probably damaging Het
Dnah7b T C 1: 46,175,419 F1115L probably damaging Het
Dock10 T C 1: 80,515,566 I1897V probably benign Het
Efcab3 A G 11: 105,109,286 I234V probably benign Het
Eid2b T G 7: 28,277,818 L13R probably damaging Het
Enam A G 5: 88,501,820 Y396C probably damaging Het
Fam161a A T 11: 23,021,006 T395S probably damaging Het
Fat1 A G 8: 45,023,160 R1748G probably benign Het
Fdxacb1 C A 9: 50,770,151 T124K possibly damaging Het
Fer1l6 A T 15: 58,641,945 D1563V possibly damaging Het
Gm20834 T C Y: 10,323,226 H70R probably damaging Het
Gucy2d T A 7: 98,449,757 M261K probably damaging Het
Hcar2 T A 5: 123,864,798 Q214L probably benign Het
Hdac11 C T 6: 91,159,232 H75Y probably damaging Het
Hoxa2 C A 6: 52,164,299 A116S probably benign Het
Ints2 A G 11: 86,215,618 C989R probably damaging Het
Jpt1 T C 11: 115,503,124 E36G probably damaging Het
Kdm5d G A Y: 914,044 R327Q possibly damaging Het
Klhl1 T C 14: 96,346,868 M309V probably benign Het
Larp4 A G 15: 99,991,778 K193E probably benign Het
Lmo3 C T 6: 138,416,502 C40Y probably damaging Het
Mcm4 A G 16: 15,630,442 V417A probably benign Het
Med8 A G 4: 118,410,979 E34G probably damaging Het
Mex3b G T 7: 82,867,906 A86S possibly damaging Het
Muc6 T C 7: 141,639,823 T1646A unknown Het
Myo15b A T 11: 115,858,744 E113D Het
Myo7a T A 7: 98,063,674 H1698L probably benign Het
Myocos T A 1: 162,657,109 M44L unknown Het
Nalcn A G 14: 123,314,087 V1036A probably damaging Het
Nfrkb C T 9: 31,414,032 Q924* probably null Het
Nol6 A G 4: 41,117,424 L923P possibly damaging Het
Nrxn3 T C 12: 89,510,462 Y472H probably damaging Het
Nudcd1 A G 15: 44,405,857 Y136H possibly damaging Het
Obox2 T C 7: 15,397,316 C116R probably damaging Het
Olfr1309 T C 2: 111,983,779 I98M probably damaging Het
Olfr1333 A G 4: 118,830,320 V39A probably damaging Het
Olfr715b T A 7: 107,106,775 I29F probably benign Het
Olfr743 T A 14: 50,534,015 V201D probably benign Het
Onecut3 A T 10: 80,495,476 S157C unknown Het
Oscp1 C T 4: 126,073,933 R91* probably null Het
Pclo A T 5: 14,712,592 D408V Het
Pde8a T C 7: 81,282,833 V81A probably benign Het
Pde8b T A 13: 95,027,743 D653V probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pik3cg T C 12: 32,195,648 Y867C probably damaging Het
Psd4 A T 2: 24,404,756 D776V possibly damaging Het
Ptprb A G 10: 116,283,429 E156G probably benign Het
Rad54b A G 4: 11,610,372 Y663C probably damaging Het
Ranbp3l T A 15: 9,002,132 V78D possibly damaging Het
Rbm12 T C 2: 156,098,218 I45V unknown Het
Rsg1 A G 4: 141,219,842 D178G probably damaging Het
Scn9a A G 2: 66,533,348 V862A probably damaging Het
Sdcbp T C 4: 6,393,089 I242T possibly damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc45a3 G T 1: 131,976,811 probably benign Het
Srpk1 T C 17: 28,594,218 I517M probably benign Het
Tmx4 A G 2: 134,639,661 M114T probably benign Het
Trhr T A 15: 44,229,231 V288D probably damaging Het
Tspoap1 A T 11: 87,761,525 I42F probably benign Het
Ttn A T 2: 76,951,512 D1063E unknown Het
Tusc3 A G 8: 39,071,481 I225V probably benign Het
Ugt2b38 A G 5: 87,424,114 S20P probably damaging Het
Upf2 A G 2: 6,027,408 T922A unknown Het
Usp38 C T 8: 81,014,561 probably benign Het
Vmn1r216 A G 13: 23,099,568 I140M probably damaging Het
Vmn2r115 T A 17: 23,346,397 N419K possibly damaging Het
Vmn2r55 C T 7: 12,670,828 G216D probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt7b C A 15: 85,537,414 R349L possibly damaging Het
Xbp1 T C 11: 5,521,098 V35A probably benign Het
Zan A T 5: 137,446,795 M1734K unknown Het
Zfhx4 A G 3: 5,412,177 E3284G probably damaging Het
Zfp458 A G 13: 67,256,914 L487S possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zp1 A G 19: 10,917,916 L324P possibly damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 109630237 missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 109656147 missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 109638706 missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 109662241 missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 109623771 missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 109623521 missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 109667525 critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 109635302 missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 109648502 critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 109630166 missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 109631276 critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 109635301 missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 109660806 missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 109631378 missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 109635380 missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 109665585 missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 109669292 missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 109638664 missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 109631345 missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 109660802 missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 109638678 missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 109631076 missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02358:Pkd1l3 APN 8 109646497 unclassified probably benign
IGL02369:Pkd1l3 APN 8 109616345 missense unknown
IGL02481:Pkd1l3 APN 8 109614782 missense unknown
IGL02505:Pkd1l3 APN 8 109633216 missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 109647500 missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 109640890 nonsense probably null
IGL02715:Pkd1l3 APN 8 109626826 missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 109662104 splice site probably benign
IGL03059:Pkd1l3 APN 8 109648367 missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 109655533 nonsense probably null
IGL03206:Pkd1l3 APN 8 109623713 missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 109662106 splice site probably benign
BB006:Pkd1l3 UTSW 8 109624195 small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 109660801 missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 109664499 missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 109628633 splice site probably benign
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0066:Pkd1l3 UTSW 8 109620471 missense unknown
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0233:Pkd1l3 UTSW 8 109650780 nonsense probably null
R0255:Pkd1l3 UTSW 8 109638754 missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 109646499 splice site probably null
R0311:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0311:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0441:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0466:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 109623663 missense probably benign 0.33
R0515:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0534:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 109623649 missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 109621708 missense unknown
R1464:Pkd1l3 UTSW 8 109636427 splice site probably benign
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1467:Pkd1l3 UTSW 8 109616368 missense unknown
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 109646953 missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 109640770 missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 109614813 missense unknown
R1574:Pkd1l3 UTSW 8 109614813 missense unknown
R1599:Pkd1l3 UTSW 8 109636384 missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 109623818 missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 109632605 missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 109648406 missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 109624199 missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 109647573 nonsense probably null
R2185:Pkd1l3 UTSW 8 109633195 missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 109620524 missense unknown
R2260:Pkd1l3 UTSW 8 109623636 missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 109628709 missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 109670721 makesense probably null
R2435:Pkd1l3 UTSW 8 109650702 missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 109623815 missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 109623990 missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 109667636 splice site probably benign
R3755:Pkd1l3 UTSW 8 109632539 missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 109636317 missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 109646879 missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 109623971 missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 109624119 missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 109632713 splice site probably null
R4893:Pkd1l3 UTSW 8 109638394 missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 109640843 missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 109665636 missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 109623155 missense unknown
R5207:Pkd1l3 UTSW 8 109633191 missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 109640792 missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 109667052 missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 109655520 missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 109630210 missense probably benign
R5623:Pkd1l3 UTSW 8 109623719 missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 109626836 missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 109640846 missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 109623179 missense unknown
R6330:Pkd1l3 UTSW 8 109646909 missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 109631384 missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 109623963 missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 109623212 missense unknown
R6480:Pkd1l3 UTSW 8 109638387 nonsense probably null
R6519:Pkd1l3 UTSW 8 109628772 missense probably benign
R6654:Pkd1l3 UTSW 8 109624283 missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 109614769 missense unknown
R6733:Pkd1l3 UTSW 8 109648494 splice site probably null
R6753:Pkd1l3 UTSW 8 109624449 missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 109626814 missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 109614614 missense unknown
R6975:Pkd1l3 UTSW 8 109660907 missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7018:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7083:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7139:Pkd1l3 UTSW 8 109636340 missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7235:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7238:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7252:Pkd1l3 UTSW 8 109660698 missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7309:Pkd1l3 UTSW 8 109648261 splice site probably null
R7362:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7462:Pkd1l3 UTSW 8 109628777 missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 109638376 missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 109633315 missense probably damaging 1.00
R7516:Pkd1l3 UTSW 8 109635229 missense probably damaging 1.00
R7553:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7559:Pkd1l3 UTSW 8 109624440 missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 109672585 missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 109638417 missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 109614572 missense unknown
R7749:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7751:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7755:Pkd1l3 UTSW 8 109630166 missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7831:Pkd1l3 UTSW 8 109631358 missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7849:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R7917:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7929:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R7952:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8054:Pkd1l3 UTSW 8 109646376 missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8099:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8276:Pkd1l3 UTSW 8 109670721 makesense probably null
R8352:Pkd1l3 UTSW 8 109624195 small deletion probably benign
R8376:Pkd1l3 UTSW 8 109623788 small deletion probably benign
R8377:Pkd1l3 UTSW 8 109635350 missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 109623888 missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 109633390 missense possibly damaging 0.85
RF016:Pkd1l3 UTSW 8 109623542 missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 109624195 small deletion probably benign
X0026:Pkd1l3 UTSW 8 109614553 missense probably null
Z1176:Pkd1l3 UTSW 8 109623242 missense unknown
Z31818:Pkd1l3 UTSW 8 109669292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACATCAGACACACCTGC -3'
(R):5'- GAGTCTTCCTGTGCCTTTGAAG -3'

Sequencing Primer
(F):5'- TCAGACACACCTGCATCCAG -3'
(R):5'- GTTTGCCAAAGATCTTCCAGCAGG -3'
Posted On2019-10-07