Incidental Mutation 'R7483:Ints2'
ID 579943
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 045557-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7483 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86106444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 989 (C989R)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably damaging
Transcript: ENSMUST00000018212
AA Change: C989R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: C989R

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108039
AA Change: C989R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: C989R

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,794,075 (GRCm39) probably null Het
Ahnak T C 19: 8,982,186 (GRCm39) S1157P probably damaging Het
Akap12 T G 10: 4,303,967 (GRCm39) V364G probably benign Het
Ankrd17 A G 5: 90,447,855 (GRCm39) S229P probably benign Het
Apof A T 10: 128,104,636 (GRCm39) Y5F probably benign Het
Arhgap24 T A 5: 102,989,174 (GRCm39) M94K probably benign Het
Ash2l G T 8: 26,312,798 (GRCm39) D479E probably damaging Het
Atp8a2 A T 14: 60,245,824 (GRCm39) C623S probably benign Het
Bmper T A 9: 23,395,238 (GRCm39) N656K probably benign Het
Braf T C 6: 39,604,772 (GRCm39) I619V possibly damaging Het
Brwd1 T C 16: 95,857,373 (GRCm39) R396G probably damaging Het
Car7 A T 8: 105,276,216 (GRCm39) T234S probably benign Het
Catsper4 A T 4: 133,945,552 (GRCm39) V169E probably damaging Het
Cemip T G 7: 83,647,784 (GRCm39) I99L probably damaging Het
Chrna7 C A 7: 62,754,738 (GRCm39) V290L probably damaging Het
Clip1 A T 5: 123,755,447 (GRCm39) D944E probably benign Het
Cplane2 A G 4: 140,947,153 (GRCm39) D178G probably damaging Het
Cyp2c68 T C 19: 39,677,581 (GRCm39) T470A probably benign Het
Dmbx1 G T 4: 115,780,908 (GRCm39) A31D probably damaging Het
Dnah7b T C 1: 46,214,579 (GRCm39) F1115L probably damaging Het
Dock10 T C 1: 80,493,283 (GRCm39) I1897V probably benign Het
Efcab3 A G 11: 105,000,112 (GRCm39) I234V probably benign Het
Eid2b T G 7: 27,977,243 (GRCm39) L13R probably damaging Het
Enam A G 5: 88,649,679 (GRCm39) Y396C probably damaging Het
Fam161a A T 11: 22,971,006 (GRCm39) T395S probably damaging Het
Fat1 A G 8: 45,476,197 (GRCm39) R1748G probably benign Het
Fdxacb1 C A 9: 50,681,451 (GRCm39) T124K possibly damaging Het
Fer1l6 A T 15: 58,513,794 (GRCm39) D1563V possibly damaging Het
Gm20834 T C Y: 10,323,226 (GRCm39) H70R probably damaging Het
Gucy2d T A 7: 98,098,964 (GRCm39) M261K probably damaging Het
Hcar2 T A 5: 124,002,861 (GRCm39) Q214L probably benign Het
Hdac11 C T 6: 91,136,214 (GRCm39) H75Y probably damaging Het
Hoxa2 C A 6: 52,141,279 (GRCm39) A116S probably benign Het
Jpt1 T C 11: 115,393,950 (GRCm39) E36G probably damaging Het
Kdm5d G A Y: 914,044 (GRCm39) R327Q possibly damaging Het
Klhl1 T C 14: 96,584,304 (GRCm39) M309V probably benign Het
Larp4 A G 15: 99,889,659 (GRCm39) K193E probably benign Het
Lmo3 C T 6: 138,393,500 (GRCm39) C40Y probably damaging Het
Mcm4 A G 16: 15,448,306 (GRCm39) V417A probably benign Het
Med8 A G 4: 118,268,176 (GRCm39) E34G probably damaging Het
Mex3b G T 7: 82,517,114 (GRCm39) A86S possibly damaging Het
Muc6 T C 7: 141,224,245 (GRCm39) T1646A unknown Het
Myo15b A T 11: 115,749,570 (GRCm39) E113D Het
Myo7a T A 7: 97,712,881 (GRCm39) H1698L probably benign Het
Myocos T A 1: 162,484,678 (GRCm39) M44L unknown Het
Nalcn A G 14: 123,551,499 (GRCm39) V1036A probably damaging Het
Nfrkb C T 9: 31,325,328 (GRCm39) Q924* probably null Het
Nol6 A G 4: 41,117,424 (GRCm39) L923P possibly damaging Het
Nrxn3 T C 12: 89,477,232 (GRCm39) Y472H probably damaging Het
Nudcd1 A G 15: 44,269,253 (GRCm39) Y136H possibly damaging Het
Obox2 T C 7: 15,131,241 (GRCm39) C116R probably damaging Het
Onecut3 A T 10: 80,331,310 (GRCm39) S157C unknown Het
Or10ak11 A G 4: 118,687,517 (GRCm39) V39A probably damaging Het
Or11g27 T A 14: 50,771,472 (GRCm39) V201D probably benign Het
Or2d2b T A 7: 106,705,982 (GRCm39) I29F probably benign Het
Or4f15 T C 2: 111,814,124 (GRCm39) I98M probably damaging Het
Oscp1 C T 4: 125,967,726 (GRCm39) R91* probably null Het
Pclo A T 5: 14,762,606 (GRCm39) D408V Het
Pde8a T C 7: 80,932,581 (GRCm39) V81A probably benign Het
Pde8b T A 13: 95,164,251 (GRCm39) D653V probably damaging Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Pik3cg T C 12: 32,245,647 (GRCm39) Y867C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Psd4 A T 2: 24,294,768 (GRCm39) D776V possibly damaging Het
Ptprb A G 10: 116,119,334 (GRCm39) E156G probably benign Het
Rad54b A G 4: 11,610,372 (GRCm39) Y663C probably damaging Het
Ranbp3l T A 15: 9,030,955 (GRCm39) V78D possibly damaging Het
Rbm12 T C 2: 155,940,138 (GRCm39) I45V unknown Het
Scn9a A G 2: 66,363,692 (GRCm39) V862A probably damaging Het
Sdcbp T C 4: 6,393,089 (GRCm39) I242T possibly damaging Het
Slc25a24 A G 3: 109,066,751 (GRCm39) T302A probably damaging Het
Slc45a3 G T 1: 131,904,549 (GRCm39) probably benign Het
Srpk1 T C 17: 28,813,192 (GRCm39) I517M probably benign Het
Tmx4 A G 2: 134,481,581 (GRCm39) M114T probably benign Het
Trhr T A 15: 44,092,627 (GRCm39) V288D probably damaging Het
Tspoap1 A T 11: 87,652,351 (GRCm39) I42F probably benign Het
Ttn A T 2: 76,781,856 (GRCm39) D1063E unknown Het
Tusc3 A G 8: 39,538,635 (GRCm39) I225V probably benign Het
Ugt2b38 A G 5: 87,571,973 (GRCm39) S20P probably damaging Het
Upf2 A G 2: 6,032,219 (GRCm39) T922A unknown Het
Usp38 C T 8: 81,741,190 (GRCm39) probably benign Het
Vmn1r216 A G 13: 23,283,738 (GRCm39) I140M probably damaging Het
Vmn2r115 T A 17: 23,565,371 (GRCm39) N419K possibly damaging Het
Vmn2r55 C T 7: 12,404,755 (GRCm39) G216D probably benign Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wnt7b C A 15: 85,421,615 (GRCm39) R349L possibly damaging Het
Xbp1 T C 11: 5,471,098 (GRCm39) V35A probably benign Het
Zan A T 5: 137,445,057 (GRCm39) M1734K unknown Het
Zfhx4 A G 3: 5,477,237 (GRCm39) E3284G probably damaging Het
Zfp458 A G 13: 67,404,978 (GRCm39) L487S possibly damaging Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Zp1 A G 19: 10,895,280 (GRCm39) L324P possibly damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAAAGACCATGATCCTTTC -3'
(R):5'- AGATCAGCTTCTCCAAGGCTCC -3'

Sequencing Primer
(F):5'- AAAGACCATGATCCTTTCTCATTTTC -3'
(R):5'- ATCTGCTTGTAGGACAGTGC -3'
Posted On 2019-10-07