Incidental Mutation 'R7483:Myo15b'
ID579947
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7483 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115858744 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 113 (E113D)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911] [ENSMUST00000103032] [ENSMUST00000177736]
Predicted Effect
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: E113D

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103032
SMART Domains Protein: ENSMUSP00000099321
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 9.17e1 SMART
WD40 62 101 7.96e0 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 3.96e1 SMART
WD40 221 258 5.7e1 SMART
Pfam:LLGL 268 372 3.2e-47 PFAM
WD40 411 451 1.38e0 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 830 879 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128826
Predicted Effect probably benign
Transcript: ENSMUST00000177736
SMART Domains Protein: ENSMUSP00000136054
Gene: ENSMUSG00000020782

DomainStartEndE-ValueType
WD40 24 60 5.9e-1 SMART
WD40 62 101 5.2e-2 SMART
Blast:WD40 112 157 6e-20 BLAST
WD40 181 217 2.5e-1 SMART
WD40 221 258 3.6e-1 SMART
Pfam:LLGL 271 372 6.2e-41 PFAM
WD40 411 451 8.8e-3 SMART
Blast:WD40 489 532 3e-12 BLAST
low complexity region 536 547 N/A INTRINSIC
Blast:WD40 576 615 2e-10 BLAST
low complexity region 649 668 N/A INTRINSIC
Blast:WD40 854 903 2e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,656,012 probably null Het
Ahnak T C 19: 9,004,822 S1157P probably damaging Het
Akap12 T G 10: 4,353,967 V364G probably benign Het
Ankrd17 A G 5: 90,299,996 S229P probably benign Het
Apof A T 10: 128,268,767 Y5F probably benign Het
Arhgap24 T A 5: 102,841,308 M94K probably benign Het
Ash2l G T 8: 25,822,770 D479E probably damaging Het
Atp8a2 A T 14: 60,008,375 C623S probably benign Het
Bmper T A 9: 23,483,942 N656K probably benign Het
Braf T C 6: 39,627,838 I619V possibly damaging Het
Brwd1 T C 16: 96,056,173 R396G probably damaging Het
Car7 A T 8: 104,549,584 T234S probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cemip T G 7: 83,998,576 I99L probably damaging Het
Chrna7 C A 7: 63,104,990 V290L probably damaging Het
Clip1 A T 5: 123,617,384 D944E probably benign Het
Cyp2c68 T C 19: 39,689,137 T470A probably benign Het
Dmbx1 G T 4: 115,923,711 A31D probably damaging Het
Dnah7b T C 1: 46,175,419 F1115L probably damaging Het
Dock10 T C 1: 80,515,566 I1897V probably benign Het
Efcab3 A G 11: 105,109,286 I234V probably benign Het
Eid2b T G 7: 28,277,818 L13R probably damaging Het
Enam A G 5: 88,501,820 Y396C probably damaging Het
Fam161a A T 11: 23,021,006 T395S probably damaging Het
Fat1 A G 8: 45,023,160 R1748G probably benign Het
Fdxacb1 C A 9: 50,770,151 T124K possibly damaging Het
Fer1l6 A T 15: 58,641,945 D1563V possibly damaging Het
Gm20834 T C Y: 10,323,226 H70R probably damaging Het
Gucy2d T A 7: 98,449,757 M261K probably damaging Het
Hcar2 T A 5: 123,864,798 Q214L probably benign Het
Hdac11 C T 6: 91,159,232 H75Y probably damaging Het
Hoxa2 C A 6: 52,164,299 A116S probably benign Het
Ints2 A G 11: 86,215,618 C989R probably damaging Het
Jpt1 T C 11: 115,503,124 E36G probably damaging Het
Kdm5d G A Y: 914,044 R327Q possibly damaging Het
Klhl1 T C 14: 96,346,868 M309V probably benign Het
Larp4 A G 15: 99,991,778 K193E probably benign Het
Lmo3 C T 6: 138,416,502 C40Y probably damaging Het
Mcm4 A G 16: 15,630,442 V417A probably benign Het
Med8 A G 4: 118,410,979 E34G probably damaging Het
Mex3b G T 7: 82,867,906 A86S possibly damaging Het
Muc6 T C 7: 141,639,823 T1646A unknown Het
Myo7a T A 7: 98,063,674 H1698L probably benign Het
Myocos T A 1: 162,657,109 M44L unknown Het
Nalcn A G 14: 123,314,087 V1036A probably damaging Het
Nfrkb C T 9: 31,414,032 Q924* probably null Het
Nol6 A G 4: 41,117,424 L923P possibly damaging Het
Nrxn3 T C 12: 89,510,462 Y472H probably damaging Het
Nudcd1 A G 15: 44,405,857 Y136H possibly damaging Het
Obox2 T C 7: 15,397,316 C116R probably damaging Het
Olfr1309 T C 2: 111,983,779 I98M probably damaging Het
Olfr1333 A G 4: 118,830,320 V39A probably damaging Het
Olfr715b T A 7: 107,106,775 I29F probably benign Het
Olfr743 T A 14: 50,534,015 V201D probably benign Het
Onecut3 A T 10: 80,495,476 S157C unknown Het
Oscp1 C T 4: 126,073,933 R91* probably null Het
Pclo A T 5: 14,712,592 D408V Het
Pde8a T C 7: 81,282,833 V81A probably benign Het
Pde8b T A 13: 95,027,743 D653V probably damaging Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pik3cg T C 12: 32,195,648 Y867C probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Psd4 A T 2: 24,404,756 D776V possibly damaging Het
Ptprb A G 10: 116,283,429 E156G probably benign Het
Rad54b A G 4: 11,610,372 Y663C probably damaging Het
Ranbp3l T A 15: 9,002,132 V78D possibly damaging Het
Rbm12 T C 2: 156,098,218 I45V unknown Het
Rsg1 A G 4: 141,219,842 D178G probably damaging Het
Scn9a A G 2: 66,533,348 V862A probably damaging Het
Sdcbp T C 4: 6,393,089 I242T possibly damaging Het
Slc25a24 A G 3: 109,159,435 T302A probably damaging Het
Slc45a3 G T 1: 131,976,811 probably benign Het
Srpk1 T C 17: 28,594,218 I517M probably benign Het
Tmx4 A G 2: 134,639,661 M114T probably benign Het
Trhr T A 15: 44,229,231 V288D probably damaging Het
Tspoap1 A T 11: 87,761,525 I42F probably benign Het
Ttn A T 2: 76,951,512 D1063E unknown Het
Tusc3 A G 8: 39,071,481 I225V probably benign Het
Ugt2b38 A G 5: 87,424,114 S20P probably damaging Het
Upf2 A G 2: 6,027,408 T922A unknown Het
Usp38 C T 8: 81,014,561 probably benign Het
Vmn1r216 A G 13: 23,099,568 I140M probably damaging Het
Vmn2r115 T A 17: 23,346,397 N419K possibly damaging Het
Vmn2r55 C T 7: 12,670,828 G216D probably benign Het
Vwa8 A C 14: 78,982,234 probably null Het
Wnt7b C A 15: 85,537,414 R349L possibly damaging Het
Xbp1 T C 11: 5,521,098 V35A probably benign Het
Zan A T 5: 137,446,795 M1734K unknown Het
Zfhx4 A G 3: 5,412,177 E3284G probably damaging Het
Zfp458 A G 13: 67,256,914 L487S possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Zp1 A G 19: 10,917,916 L324P possibly damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
R6963:Myo15b UTSW 11 115890714 splice site probably null
R7015:Myo15b UTSW 11 115871844 missense
R7020:Myo15b UTSW 11 115866667 nonsense probably null
R7096:Myo15b UTSW 11 115891498 splice site probably null
R7219:Myo15b UTSW 11 115877095 critical splice donor site probably null
R7400:Myo15b UTSW 11 115860113 missense
R7413:Myo15b UTSW 11 115878144 missense
R7523:Myo15b UTSW 11 115890858 missense unknown
R7737:Myo15b UTSW 11 115887923 missense unknown
R7784:Myo15b UTSW 11 115861340 missense
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGACATCGGGAAGTCAGTC -3'
(R):5'- TTCTGACCTGGGATCCGAAG -3'

Sequencing Primer
(F):5'- TCGGGAAGTCAGTCATGGGC -3'
(R):5'- CCATTTTGGGTGGCCGCTC -3'
Posted On2019-10-07