Incidental Mutation 'R7484:Acacb'
ID579991
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7484 (G1)
Quality Score220.009
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114218862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1285 (V1285I)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect probably damaging
Transcript: ENSMUST00000031583
AA Change: V1285I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V1285I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102582
AA Change: V1285I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V1285I

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cbx5 A C 15: 103,205,829 probably null Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Dscaml1 A G 9: 45,749,446 probably null Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Erich6 A T 3: 58,626,691 probably null Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Golim4 G T 3: 75,898,135 probably null Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Hid1 T C 11: 115,352,581 probably null Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slc26a3 T C 12: 31,447,788 V47A probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAATCTAGGGGCTTCCTCAG -3'
(R):5'- AAGACTGCAGGAGACCTATGGC -3'

Sequencing Primer
(F):5'- AATCTAGGGGCTTCCTCAGGAATG -3'
(R):5'- ATACTTGCTGGATCCTCCCGAAG -3'
Posted On2019-10-07