Incidental Mutation 'R7484:Zfp30'
ID579995
Institutional Source Beutler Lab
Gene Symbol Zfp30
Ensembl Gene ENSMUSG00000047473
Gene Namezinc finger protein 30
SynonymsZfp-30, 2610306P15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7484 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location29783998-29794702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29792806 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 243 (Y243H)
Ref Sequence ENSEMBL: ENSMUSP00000032803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032803] [ENSMUST00000122387]
Predicted Effect probably benign
Transcript: ENSMUST00000032803
AA Change: Y243H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032803
Gene: ENSMUSG00000047473
AA Change: Y243H

DomainStartEndE-ValueType
KRAB 21 82 4.61e-37 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 7.78e-3 SMART
ZnF_C2H2 243 265 5.06e-2 SMART
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 319 3.72e0 SMART
ZnF_C2H2 327 349 3.24e0 SMART
ZnF_C2H2 355 377 3.89e-3 SMART
ZnF_C2H2 383 405 4.79e-3 SMART
ZnF_C2H2 411 433 1.36e-2 SMART
ZnF_C2H2 439 461 1.36e-2 SMART
ZnF_C2H2 467 489 7.26e-3 SMART
ZnF_C2H2 495 517 2.09e-3 SMART
ZnF_C2H2 523 545 6.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122387
AA Change: Y162H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113426
Gene: ENSMUSG00000047473
AA Change: Y162H

DomainStartEndE-ValueType
ZnF_C2H2 106 128 5.9e-3 SMART
ZnF_C2H2 134 156 7.78e-3 SMART
ZnF_C2H2 162 184 5.06e-2 SMART
ZnF_C2H2 190 212 1.47e-3 SMART
ZnF_C2H2 218 238 3.72e0 SMART
ZnF_C2H2 246 268 3.24e0 SMART
ZnF_C2H2 274 296 3.89e-3 SMART
ZnF_C2H2 302 324 4.79e-3 SMART
ZnF_C2H2 330 352 1.36e-2 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 386 408 7.26e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 6.78e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Zfp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
elo UTSW 7 29793066 nonsense probably null
R0022:Zfp30 UTSW 7 29792435 missense possibly damaging 0.68
R0218:Zfp30 UTSW 7 29793638 missense probably damaging 1.00
R0349:Zfp30 UTSW 7 29793604 missense probably damaging 1.00
R0537:Zfp30 UTSW 7 29792735 missense probably damaging 0.98
R0653:Zfp30 UTSW 7 29792753 missense probably damaging 1.00
R1836:Zfp30 UTSW 7 29793380 missense probably damaging 0.96
R1966:Zfp30 UTSW 7 29792452 missense probably benign
R2100:Zfp30 UTSW 7 29793526 missense probably benign 0.30
R3696:Zfp30 UTSW 7 29793390 missense probably damaging 1.00
R3723:Zfp30 UTSW 7 29793353 missense probably damaging 0.97
R4571:Zfp30 UTSW 7 29793202 missense probably damaging 1.00
R5027:Zfp30 UTSW 7 29793066 nonsense probably null
R5070:Zfp30 UTSW 7 29786266 utr 5 prime probably benign
R6013:Zfp30 UTSW 7 29789421 missense possibly damaging 0.79
R7274:Zfp30 UTSW 7 29792618 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCACACCTGTTAGTCTC -3'
(R):5'- CACTGTTGAGCCTCTGATGC -3'

Sequencing Primer
(F):5'- GTCTCTATCAGAAAACTCCTAACGG -3'
(R):5'- TACCTGCCGGAAGCTCTTG -3'
Posted On2019-10-07