Incidental Mutation 'R7484:Vwa8'
ID580019
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Namevon Willebrand factor A domain containing 8
Synonyms4932416F07Rik, 1300010F03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7484 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location78849052-79202310 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 78982234 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
Predicted Effect probably null
Transcript: ENSMUST00000040990
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000227255
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
R6812_Vwa8_870 UTSW 14 79197419 missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79183061 missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1539:Vwa8 UTSW 14 79062562 missense probably benign 0.00
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6057:Vwa8 UTSW 14 79082873 missense probably benign 0.21
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 78912205 missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79038201 missense probably null 1.00
R7363:Vwa8 UTSW 14 79018707 missense probably benign 0.05
R7381:Vwa8 UTSW 14 79095685 missense probably benign 0.00
R7406:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79082814 missense probably benign 0.24
R7500:Vwa8 UTSW 14 78925246 intron probably null
R7514:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 78935229 missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79098300 missense probably benign
R7703:Vwa8 UTSW 14 79026073 missense probably damaging 1.00
R7730:Vwa8 UTSW 14 78995149 missense probably benign 0.00
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GGGAAATACCTAAAGCTTTCTGG -3'
(R):5'- CCTCAGGACCTGAAATCTCAGTG -3'

Sequencing Primer
(F):5'- ACCTAAAGCTTTCTGGTGATATTTC -3'
(R):5'- CAGGACCTGAAATCTCAGTGTTTAGG -3'
Posted On2019-10-07