Incidental Mutation 'R7484:Adamts12'
ID 580021
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
Synonyms AI605170; ADAMTS-12
MMRRC Submission
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7484 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11064790-11349231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 11345648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1592 (Q1592K)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: Q1592K

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: Q1592K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cbx5 A C 15: 103,205,829 probably null Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Dscaml1 A G 9: 45,749,446 probably null Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Erich6 A T 3: 58,626,691 probably null Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Golim4 G T 3: 75,898,135 probably null Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Hid1 T C 11: 115,352,581 probably null Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slc26a3 T C 12: 31,447,788 V47A probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1748:Adamts12 UTSW 15 11241462 missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
R9042:Adamts12 UTSW 15 11152048 missense probably benign 0.08
R9162:Adamts12 UTSW 15 11311635 missense probably benign 0.29
R9190:Adamts12 UTSW 15 11336360 missense probably benign 0.02
R9700:Adamts12 UTSW 15 11311356 missense probably benign 0.04
R9748:Adamts12 UTSW 15 11310542 missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- GAGCCTAACCTAGCATTTGGCC -3'
(R):5'- GGAACATTTTGTGGCTAGACAC -3'

Sequencing Primer
(F):5'- ATTCTCTGTGCGATGACCAG -3'
(R):5'- TGTGGCTAGACACACACATTG -3'
Posted On 2019-10-07