Incidental Mutation 'R7484:Adamts12'
ID 580021
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 045558-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7484 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 11345734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1592 (Q1592K)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: Q1592K

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: Q1592K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 A G 4: 144,504,521 (GRCm39) L210P probably damaging Het
Acacb G A 5: 114,356,923 (GRCm39) V1285I probably damaging Het
Acly A T 11: 100,386,789 (GRCm39) I591N probably damaging Het
Acr T A 15: 89,457,427 (GRCm39) V225E probably damaging Het
Actr8 A G 14: 29,714,925 (GRCm39) D580G probably damaging Het
Aire T C 10: 77,878,404 (GRCm39) E138G probably damaging Het
Apob C T 12: 8,056,884 (GRCm39) Q1789* probably null Het
Cbx5 A C 15: 103,114,256 (GRCm39) probably null Het
Cd300lb A T 11: 114,819,345 (GRCm39) W95R probably damaging Het
Cdc16 A G 8: 13,827,605 (GRCm39) T504A probably benign Het
Cenpf A G 1: 189,389,018 (GRCm39) S1605P probably damaging Het
Ckap2l A G 2: 129,114,455 (GRCm39) V596A possibly damaging Het
Cntn1 T C 15: 92,151,922 (GRCm39) W454R probably benign Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Csf2rb A G 15: 78,223,099 (GRCm39) T104A possibly damaging Het
Cyp4a12b A G 4: 115,289,760 (GRCm39) D209G possibly damaging Het
Ddx23 T C 15: 98,546,570 (GRCm39) E533G probably damaging Het
Dscaml1 A G 9: 45,660,744 (GRCm39) probably null Het
Eif3l T G 15: 78,968,336 (GRCm39) C202G probably benign Het
Ephx4 T G 5: 107,577,612 (GRCm39) M312R probably damaging Het
Erich6 A T 3: 58,534,112 (GRCm39) probably null Het
Far2 G A 6: 148,075,411 (GRCm39) D424N probably damaging Het
Fat1 C A 8: 45,489,221 (GRCm39) N3497K probably damaging Het
Fstl3 G A 10: 79,615,865 (GRCm39) C117Y probably damaging Het
Fyb2 A T 4: 104,870,499 (GRCm39) H700L probably benign Het
Gm8356 T A 14: 17,691,282 (GRCm39) M128L probably benign Het
Golim4 G T 3: 75,805,442 (GRCm39) probably null Het
Grm1 T G 10: 10,622,403 (GRCm39) D440A probably benign Het
Gtf2a1 A G 12: 91,529,747 (GRCm39) V322A probably benign Het
Hid1 T C 11: 115,243,407 (GRCm39) probably null Het
Igfals G A 17: 25,098,962 (GRCm39) V18M possibly damaging Het
Klk1b24 G T 7: 43,839,688 (GRCm39) probably null Het
Lmbr1 T C 5: 29,551,850 (GRCm39) probably benign Het
Lrrc40 T C 3: 157,746,194 (GRCm39) S90P probably benign Het
Mapk9 T C 11: 49,763,663 (GRCm39) Y185H probably damaging Het
Marveld2 C T 13: 100,748,068 (GRCm39) G337D probably damaging Het
Mga G T 2: 119,776,710 (GRCm39) R1539L probably damaging Het
Mllt6 T A 11: 97,563,442 (GRCm39) S342T probably benign Het
Ms4a6c T C 19: 11,449,893 (GRCm39) probably null Het
Muc16 T A 9: 18,558,064 (GRCm39) H2743L unknown Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Or10ag60 T C 2: 87,438,281 (GRCm39) F183S probably damaging Het
Or2l13 A G 16: 19,305,753 (GRCm39) H55R possibly damaging Het
Plcd3 T G 11: 102,962,545 (GRCm39) K635N probably damaging Het
Prkch T A 12: 73,632,301 (GRCm39) probably null Het
Rb1cc1 T C 1: 6,344,441 (GRCm39) V1570A probably damaging Het
Rp1 T C 1: 4,415,704 (GRCm39) N1803D probably benign Het
Rufy3 T A 5: 88,746,331 (GRCm39) V72E probably benign Het
Secisbp2l G A 2: 125,613,452 (GRCm39) Q181* probably null Het
Sgcb A G 5: 73,797,188 (GRCm39) F191L possibly damaging Het
Sgsh T A 11: 119,237,183 (GRCm39) D477V probably damaging Het
Shoc1 A T 4: 59,062,286 (GRCm39) V924E probably damaging Het
Slc22a28 C A 19: 8,048,492 (GRCm39) S385I probably benign Het
Slc26a3 T C 12: 31,497,787 (GRCm39) V47A probably benign Het
Slco2a1 A T 9: 102,945,185 (GRCm39) I187F probably damaging Het
Sltm T C 9: 70,481,179 (GRCm39) S344P unknown Het
Sort1 A G 3: 108,246,141 (GRCm39) T373A probably damaging Het
Stab1 A G 14: 30,882,274 (GRCm39) F474L probably benign Het
Tbc1d5 G T 17: 51,224,573 (GRCm39) A326E possibly damaging Het
Tcstv4 A T 13: 120,770,017 (GRCm39) K112N probably damaging Het
Vwa8 A C 14: 79,219,674 (GRCm39) probably null Het
Wdr70 G A 15: 7,951,562 (GRCm39) T425I probably benign Het
Zfp30 T C 7: 29,492,231 (GRCm39) Y243H probably benign Het
Zfp974 A T 7: 27,611,559 (GRCm39) N55K possibly damaging Het
Zftraf1 A G 15: 76,530,435 (GRCm39) L295P probably damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCTAACCTAGCATTTGGCC -3'
(R):5'- GGAACATTTTGTGGCTAGACAC -3'

Sequencing Primer
(F):5'- ATTCTCTGTGCGATGACCAG -3'
(R):5'- TGTGGCTAGACACACACATTG -3'
Posted On 2019-10-07