Incidental Mutation 'R7484:Csf2rb'
ID 580023
Institutional Source Beutler Lab
Gene Symbol Csf2rb
Ensembl Gene ENSMUSG00000071713
Gene Name colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms Csf2rb1, AIC2B, Il5rb, Bc, Il3rb1, beta c, Il3r, common beta chain, CDw131
MMRRC Submission
Accession Numbers

Genbank: NM_007780; MGI: 1339759

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7484 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 78325752-78353847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78338899 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 104 (T104A)
Ref Sequence ENSEMBL: ENSMUSP00000094082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096355] [ENSMUST00000229034] [ENSMUST00000229678] [ENSMUST00000230264] [ENSMUST00000231888]
AlphaFold P26955
Predicted Effect possibly damaging
Transcript: ENSMUST00000096355
AA Change: T104A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094082
Gene: ENSMUSG00000071713
AA Change: T104A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SCOP:d1gh7a1 29 130 6e-58 SMART
FN3 136 224 4.44e0 SMART
Blast:FN3 245 338 3e-24 BLAST
SCOP:d1gh7a3 245 338 2e-45 SMART
FN3 343 426 2.41e0 SMART
transmembrane domain 446 468 N/A INTRINSIC
low complexity region 716 743 N/A INTRINSIC
low complexity region 824 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229034
Predicted Effect possibly damaging
Transcript: ENSMUST00000229678
AA Change: T104A

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230264
AA Change: T104A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231888
AA Change: T42A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit lung pathology including lymphocytic infiltration, alveolar proteinosis-like areas, and increased saturated phosphatidylcholine pool sizes. Mutants also have low peripheral eosinophil numbers. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(3) Targeted, other(4)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Acr T A 15: 89,573,224 V225E probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cbx5 A C 15: 103,205,829 probably null Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Dscaml1 A G 9: 45,749,446 probably null Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Erich6 A T 3: 58,626,691 probably null Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Golim4 G T 3: 75,898,135 probably null Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Hid1 T C 11: 115,352,581 probably null Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slc26a3 T C 12: 31,447,788 V47A probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Csf2rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Csf2rb APN 15 78348514 nonsense probably null
IGL00979:Csf2rb APN 15 78348104 missense probably damaging 1.00
IGL01613:Csf2rb APN 15 78335302 intron probably benign
IGL01724:Csf2rb APN 15 78336414 missense probably damaging 1.00
IGL01942:Csf2rb APN 15 78340492 missense probably benign
IGL02479:Csf2rb APN 15 78341724 nonsense probably null
3-1:Csf2rb UTSW 15 78344603 missense probably damaging 1.00
IGL02802:Csf2rb UTSW 15 78338903 missense probably benign 0.00
R0133:Csf2rb UTSW 15 78339004 unclassified probably benign
R0179:Csf2rb UTSW 15 78336372 missense possibly damaging 0.52
R0487:Csf2rb UTSW 15 78348331 missense probably benign 0.00
R1544:Csf2rb UTSW 15 78340755 missense probably benign 0.02
R1619:Csf2rb UTSW 15 78335211 missense probably damaging 0.99
R1690:Csf2rb UTSW 15 78348644 missense probably benign 0.11
R1831:Csf2rb UTSW 15 78348253 missense probably benign 0.03
R3970:Csf2rb UTSW 15 78341467 missense probably benign
R4922:Csf2rb UTSW 15 78346467 missense probably benign 0.02
R5151:Csf2rb UTSW 15 78340581 missense probably damaging 1.00
R5202:Csf2rb UTSW 15 78349057 missense possibly damaging 0.51
R5398:Csf2rb UTSW 15 78348620 missense probably benign
R5496:Csf2rb UTSW 15 78340561 missense probably damaging 1.00
R5786:Csf2rb UTSW 15 78348955 missense probably damaging 1.00
R6166:Csf2rb UTSW 15 78344566 missense probably damaging 1.00
R6347:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6350:Csf2rb UTSW 15 78345552 missense probably damaging 0.99
R6899:Csf2rb UTSW 15 78340702 missense probably benign 0.01
R6984:Csf2rb UTSW 15 78345519 missense probably damaging 1.00
R7671:Csf2rb UTSW 15 78338930 missense probably damaging 1.00
R7751:Csf2rb UTSW 15 78341639 missense probably damaging 1.00
R7781:Csf2rb UTSW 15 78344571 missense probably benign 0.00
R7861:Csf2rb UTSW 15 78349157 missense probably damaging 1.00
R8135:Csf2rb UTSW 15 78348119 missense possibly damaging 0.95
R8154:Csf2rb UTSW 15 78340442 critical splice acceptor site probably null
R8299:Csf2rb UTSW 15 78346469 missense possibly damaging 0.88
R8315:Csf2rb UTSW 15 78347381 missense possibly damaging 0.83
R8926:Csf2rb UTSW 15 78340549 missense probably benign
R8948:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R8950:Csf2rb UTSW 15 78348320 missense probably benign 0.05
R9265:Csf2rb UTSW 15 78348546 missense probably benign 0.08
X0024:Csf2rb UTSW 15 78336360 missense probably damaging 1.00
X0028:Csf2rb UTSW 15 78349002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCATTGCCAGACACTGC -3'
(R):5'- CACCTGGAAAGTCCTATAGGAG -3'

Sequencing Primer
(F):5'- CACTGCCCTTGGATAAAAGCAGG -3'
(R):5'- CAAGACATGGTCCCTAATTCTGGG -3'
Posted On 2019-10-07