Incidental Mutation 'R7484:Acr'
ID580025
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7484 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89573224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 225 (V225E)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect probably damaging
Transcript: ENSMUST00000023295
AA Change: V225E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: V225E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,218,862 V1285I probably damaging Het
Acly A T 11: 100,495,963 I591N probably damaging Het
Actr8 A G 14: 29,992,968 D580G probably damaging Het
Adamts12 C A 15: 11,345,648 Q1592K probably benign Het
AI481877 A T 4: 59,062,286 V924E probably damaging Het
Aire T C 10: 78,042,570 E138G probably damaging Het
Apob C T 12: 8,006,884 Q1789* probably null Het
BC147527 A T 13: 120,308,481 K112N probably damaging Het
Cbx5 A C 15: 103,205,829 probably null Het
Cd300lb A T 11: 114,928,519 W95R probably damaging Het
Cdc16 A G 8: 13,777,605 T504A probably benign Het
Cenpf A G 1: 189,656,821 S1605P probably damaging Het
Ckap2l A G 2: 129,272,535 V596A possibly damaging Het
Cntn1 T C 15: 92,254,041 W454R probably benign Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Csf2rb A G 15: 78,338,899 T104A possibly damaging Het
Cyhr1 A G 15: 76,646,235 L295P probably damaging Het
Cyp4a12b A G 4: 115,432,563 D209G possibly damaging Het
Ddx23 T C 15: 98,648,689 E533G probably damaging Het
Dscaml1 A G 9: 45,749,446 probably null Het
Eif3l T G 15: 79,084,136 C202G probably benign Het
Ephx4 T G 5: 107,429,746 M312R probably damaging Het
Erich6 A T 3: 58,626,691 probably null Het
Far2 G A 6: 148,173,913 D424N probably damaging Het
Fat1 C A 8: 45,036,184 N3497K probably damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Fyb2 A T 4: 105,013,302 H700L probably benign Het
Gm438 A G 4: 144,777,951 L210P probably damaging Het
Gm8356 T A 14: 6,535,135 M128L probably benign Het
Golim4 G T 3: 75,898,135 probably null Het
Grm1 T G 10: 10,746,659 D440A probably benign Het
Gtf2a1 A G 12: 91,562,973 V322A probably benign Het
Hid1 T C 11: 115,352,581 probably null Het
Igfals G A 17: 24,879,988 V18M possibly damaging Het
Klk1b24 G T 7: 44,190,264 probably null Het
Lmbr1 T C 5: 29,346,852 probably benign Het
Lrrc40 T C 3: 158,040,557 S90P probably benign Het
Mapk9 T C 11: 49,872,836 Y185H probably damaging Het
Marveld2 C T 13: 100,611,560 G337D probably damaging Het
Mga G T 2: 119,946,229 R1539L probably damaging Het
Mllt6 T A 11: 97,672,616 S342T probably benign Het
Ms4a6c T C 19: 11,472,529 probably null Het
Muc16 T A 9: 18,646,768 H2743L unknown Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1130 T C 2: 87,607,937 F183S probably damaging Het
Olfr166 A G 16: 19,487,003 H55R possibly damaging Het
Plcd3 T G 11: 103,071,719 K635N probably damaging Het
Prkch T A 12: 73,585,527 probably null Het
Rb1cc1 T C 1: 6,274,217 V1570A probably damaging Het
Rp1 T C 1: 4,345,481 N1803D probably benign Het
Rufy3 T A 5: 88,598,472 V72E probably benign Het
Secisbp2l G A 2: 125,771,532 Q181* probably null Het
Sgcb A G 5: 73,639,845 F191L possibly damaging Het
Sgsh T A 11: 119,346,357 D477V probably damaging Het
Slc22a28 C A 19: 8,071,127 S385I probably benign Het
Slc26a3 T C 12: 31,447,788 V47A probably benign Het
Slco2a1 A T 9: 103,067,986 I187F probably damaging Het
Sltm T C 9: 70,573,897 S344P unknown Het
Sort1 A G 3: 108,338,825 T373A probably damaging Het
Stab1 A G 14: 31,160,317 F474L probably benign Het
Tbc1d5 G T 17: 50,917,545 A326E possibly damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wdr70 G A 15: 7,922,081 T425I probably benign Het
Zfp30 T C 7: 29,792,806 Y243H probably benign Het
Zfp974 A T 7: 27,912,134 N55K possibly damaging Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0398:Acr UTSW 15 89573941 missense probably damaging 1.00
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R1792:Acr UTSW 15 89573143 missense probably benign 0.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5531:Acr UTSW 15 89573943 missense probably damaging 1.00
R5577:Acr UTSW 15 89574238 missense probably benign 0.01
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
R7548:Acr UTSW 15 89574393 missense possibly damaging 0.72
R8001:Acr UTSW 15 89573962 missense probably damaging 1.00
Z1177:Acr UTSW 15 89569879 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGGGAGCTTTGTTAACCAG -3'
(R):5'- AAGTCACTGGAGTTGCTGGC -3'

Sequencing Primer
(F):5'- CTTTGTTAACCAGAGCGCTGCATAG -3'
(R):5'- CCCTCGGGCAAGAAAGG -3'
Posted On2019-10-07