Incidental Mutation 'R7485:Lgalsl2'
ID 580063
Institutional Source Beutler Lab
Gene Symbol Lgalsl2
Ensembl Gene ENSMUSG00000048398
Gene Name galectin like 2
Synonyms Gm5065
MMRRC Submission 045559-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R7485 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 5353541-5363681 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 5362440 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 24 (R24C)
Ref Sequence ENSEMBL: ENSMUSP00000055799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056639] [ENSMUST00000207531]
AlphaFold Q7TPX9
Predicted Effect probably benign
Transcript: ENSMUST00000056639
AA Change: R24C

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055799
Gene: ENSMUSG00000048398
AA Change: R24C

DomainStartEndE-ValueType
GLECT 31 165 1.56e-15 SMART
Gal-bind_lectin 37 165 2.51e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207531
AA Change: R24C

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat3 C T 10: 80,442,234 (GRCm39) A24V probably benign Het
Agbl1 A T 7: 76,239,241 (GRCm39) E832D unknown Het
Akap8l G A 17: 32,554,545 (GRCm39) S347L probably benign Het
Ankmy1 G T 1: 92,804,379 (GRCm39) A868E probably damaging Het
Ankrd49 A T 9: 14,693,837 (GRCm39) L110* probably null Het
Aoc3 A G 11: 101,228,229 (GRCm39) T679A probably damaging Het
Ap1s3 A G 1: 79,592,018 (GRCm39) Y111H probably damaging Het
Arnt T A 3: 95,402,659 (GRCm39) N777K probably damaging Het
Atp4b A T 8: 13,436,732 (GRCm39) M260K probably benign Het
Bcl2l15 A T 3: 103,740,729 (GRCm39) D65V probably damaging Het
Bicdl1 G T 5: 115,801,845 (GRCm39) S340* probably null Het
Ccdc15 T C 9: 37,226,574 (GRCm39) R467G probably benign Het
Ccdc68 T A 18: 70,102,084 (GRCm39) M327K possibly damaging Het
Ccdc83 T C 7: 89,873,138 (GRCm39) T406A probably benign Het
Ccnf A T 17: 24,468,232 (GRCm39) V55D probably damaging Het
Cdcp3 C A 7: 130,830,562 (GRCm39) P332Q probably damaging Het
Cldn12 A G 5: 5,558,008 (GRCm39) F140L probably benign Het
Copb1 A C 7: 113,844,720 (GRCm39) I213S possibly damaging Het
Cps1 G A 1: 67,179,016 (GRCm39) G76D probably damaging Het
Ctrc A G 4: 141,567,627 (GRCm39) W159R probably damaging Het
Cul4a C T 8: 13,190,279 (GRCm39) T572M possibly damaging Het
Cyp2c40 A T 19: 39,796,050 (GRCm39) Y109* probably null Het
Dcc A G 18: 71,553,317 (GRCm39) Y780H probably benign Het
Dctn1 C T 6: 83,166,887 (GRCm39) A283V possibly damaging Het
Dio1 T C 4: 107,154,874 (GRCm39) D134G probably benign Het
Dlg5 A T 14: 24,198,390 (GRCm39) D1514E probably benign Het
Dlg5 A T 14: 24,227,907 (GRCm39) L338Q probably damaging Het
Dlgap2 A T 8: 14,879,952 (GRCm39) K767N probably damaging Het
Dst A T 1: 34,313,270 (GRCm39) I4346F probably benign Het
Dzip1l T C 9: 99,543,065 (GRCm39) F507L probably benign Het
Erich2 A T 2: 70,362,109 (GRCm39) D300V probably damaging Het
Fam114a2 C T 11: 57,404,515 (GRCm39) G83D probably damaging Het
Fam131a C T 16: 20,520,444 (GRCm39) A299V probably benign Het
Fbln2 A G 6: 91,247,143 (GRCm39) probably null Het
Fbn2 T C 18: 58,204,912 (GRCm39) D1177G possibly damaging Het
Fbxl6 T C 15: 76,422,113 (GRCm39) probably null Het
Frem3 A T 8: 81,339,965 (GRCm39) I753F probably damaging Het
Gfra1 A G 19: 58,288,744 (GRCm39) S234P probably damaging Het
Gtse1 T A 15: 85,752,901 (GRCm39) S339T probably benign Het
Hdgfl3 T C 7: 81,550,106 (GRCm39) N76S probably benign Het
Herc6 A G 6: 57,558,089 (GRCm39) E23G probably benign Het
Hid1 T A 11: 115,245,545 (GRCm39) H420L probably damaging Het
Igsf21 G A 4: 139,755,049 (GRCm39) T440I probably benign Het
Ikzf4 T A 10: 128,468,451 (GRCm39) H676L unknown Het
Il18r1 A G 1: 40,520,140 (GRCm39) E177G probably benign Het
Iqch A G 9: 63,415,599 (GRCm39) Y558H possibly damaging Het
Kif11 A T 19: 37,399,072 (GRCm39) N752I possibly damaging Het
Kntc1 T A 5: 123,925,019 (GRCm39) C1111S possibly damaging Het
Krtap9-5 A G 11: 99,839,800 (GRCm39) K167R unknown Het
Lipe G T 7: 25,080,036 (GRCm39) T704K probably benign Het
Lrrc32 A T 7: 98,147,414 (GRCm39) I65F possibly damaging Het
Mogs C T 6: 83,093,188 (GRCm39) H179Y probably damaging Het
Mtnr1b A T 9: 15,774,590 (GRCm39) Y156* probably null Het
Mtus1 T C 8: 41,537,590 (GRCm39) H42R probably benign Het
Mx2 T A 16: 97,346,918 (GRCm39) D128E probably benign Het
Myof A T 19: 37,939,939 (GRCm39) L829* probably null Het
Naip6 T C 13: 100,420,359 (GRCm39) K1304E probably benign Het
Neo1 A C 9: 58,791,826 (GRCm39) S1307R probably benign Het
Nipbl A T 15: 8,359,779 (GRCm39) D1475E probably benign Het
Nlrp9b T A 7: 19,757,875 (GRCm39) F371I probably damaging Het
Nrip1 A T 16: 76,088,338 (GRCm39) M1073K probably damaging Het
Obox6 T C 7: 15,567,863 (GRCm39) N195D probably damaging Het
Or13a18 T A 7: 140,190,091 (GRCm39) I4K probably benign Het
Or1j18 T A 2: 36,624,650 (GRCm39) F106I probably benign Het
Or5ac24 A T 16: 59,165,687 (GRCm39) C126S probably damaging Het
Or5b99 C T 19: 12,976,922 (GRCm39) H191Y probably benign Het
Or5p64 C A 7: 107,855,045 (GRCm39) C100F probably damaging Het
Pax7 T C 4: 139,511,880 (GRCm39) K232E probably benign Het
Phldb3 C T 7: 24,310,689 (GRCm39) probably benign Het
Pkd1l1 C A 11: 8,915,148 (GRCm39) V131L Het
Ppp2r5a A G 1: 191,128,532 (GRCm39) S28P probably benign Het
Prl8a1 A G 13: 27,758,068 (GRCm39) S214P probably damaging Het
Prmt2 A T 10: 76,056,838 (GRCm39) C228* probably null Het
Prpf8 C T 11: 75,399,738 (GRCm39) R2266* probably null Het
Rabl6 A G 2: 25,474,153 (GRCm39) S648P unknown Het
Ralgapa1 T C 12: 55,759,457 (GRCm39) K1022R probably damaging Het
Ralgapb T A 2: 158,285,275 (GRCm39) D591E probably benign Het
Rprd1a A G 18: 24,639,889 (GRCm39) probably null Het
Rsu1 T C 2: 13,221,686 (GRCm39) R165G probably damaging Het
Samd8 A G 14: 21,842,491 (GRCm39) E334G probably benign Het
Scn9a T A 2: 66,364,561 (GRCm39) Q804L probably damaging Het
Sez6 A G 11: 77,864,711 (GRCm39) D557G probably benign Het
Sgsm1 A T 5: 113,427,501 (GRCm39) probably null Het
Slc17a3 T A 13: 24,039,832 (GRCm39) M290K Het
Snd1 T A 6: 28,531,449 (GRCm39) V330E probably benign Het
Tceanc2 T C 4: 107,022,852 (GRCm39) K45R probably damaging Het
Tg A T 15: 66,568,437 (GRCm39) I1375F probably benign Het
Tmem116 T A 5: 121,633,124 (GRCm39) I357K Het
Tmem39a G T 16: 38,408,658 (GRCm39) R407L possibly damaging Het
Tmem74 A T 15: 43,730,761 (GRCm39) M94K probably benign Het
Tpp1 C T 7: 105,398,751 (GRCm39) C226Y probably damaging Het
Trbv21 T C 6: 41,179,861 (GRCm39) I59T not run Het
Trim11 A G 11: 58,869,463 (GRCm39) D133G probably benign Het
Uaca G A 9: 60,753,282 (GRCm39) V76I probably damaging Het
Ugt2a3 A G 5: 87,475,539 (GRCm39) probably null Het
Vmn2r104 G T 17: 20,249,737 (GRCm39) H845N probably benign Het
Wdr24 T C 17: 26,045,101 (GRCm39) Y279H probably damaging Het
Zbtb46 A G 2: 181,065,512 (GRCm39) S213P probably benign Het
Zdhhc13 C A 7: 48,461,103 (GRCm39) Y346* probably null Het
Zfp280b A T 10: 75,875,075 (GRCm39) H318L probably damaging Het
Other mutations in Lgalsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02060:Lgalsl2 APN 7 5,362,563 (GRCm39) missense probably damaging 0.99
IGL02147:Lgalsl2 APN 7 5,362,732 (GRCm39) missense probably damaging 1.00
R0771:Lgalsl2 UTSW 7 5,362,822 (GRCm39) missense probably damaging 1.00
R0906:Lgalsl2 UTSW 7 5,362,828 (GRCm39) missense probably damaging 0.99
R2018:Lgalsl2 UTSW 7 5,362,573 (GRCm39) missense probably benign 0.18
R2258:Lgalsl2 UTSW 7 5,362,401 (GRCm39) missense probably benign
R2519:Lgalsl2 UTSW 7 5,362,833 (GRCm39) missense probably damaging 1.00
R2865:Lgalsl2 UTSW 7 5,362,668 (GRCm39) missense probably benign 0.25
R5893:Lgalsl2 UTSW 7 5,362,623 (GRCm39) missense probably benign 0.00
R7716:Lgalsl2 UTSW 7 5,362,819 (GRCm39) missense possibly damaging 0.56
R7836:Lgalsl2 UTSW 7 5,362,507 (GRCm39) missense probably damaging 1.00
R7898:Lgalsl2 UTSW 7 5,362,441 (GRCm39) missense probably benign 0.22
R8192:Lgalsl2 UTSW 7 5,362,595 (GRCm39) missense possibly damaging 0.77
R9324:Lgalsl2 UTSW 7 5,362,527 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CATAAAAGGTCCTTTGGTGGGG -3'
(R):5'- GAGTTCAATCGCCACATCGG -3'

Sequencing Primer
(F):5'- TCATGGGAAAGAGGCTTACGTG -3'
(R):5'- ACATCGGCAGGAGGATCTTC -3'
Posted On 2019-10-07