Incidental Mutation 'R7485:Copb1'
ID580075
Institutional Source Beutler Lab
Gene Symbol Copb1
Ensembl Gene ENSMUSG00000030754
Gene Namecoatomer protein complex, subunit beta 1
SynonymsCopb1, 2610019B04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_033370; MGI: 1917599

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R7485 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location114215559-114254711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114245485 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 213 (I213S)
Ref Sequence ENSEMBL: ENSMUSP00000033012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033012]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033012
AA Change: I213S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033012
Gene: ENSMUSG00000030754
AA Change: I213S

DomainStartEndE-ValueType
Pfam:Adaptin_N 19 539 2.4e-124 PFAM
low complexity region 643 660 N/A INTRINSIC
Pfam:Coatamer_beta_C 667 807 3.6e-63 PFAM
Pfam:Coatomer_b_Cpla 813 944 3.1e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Fbln2 A G 6: 91,270,161 probably null Het
Fbn2 T C 18: 58,071,840 D1177G possibly damaging Het
Fbxl6 T C 15: 76,537,913 probably null Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Naip6 T C 13: 100,283,851 K1304E probably benign Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Pkd1l1 C A 11: 8,965,148 V131L Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Sgsm1 A T 5: 113,279,635 probably null Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Trim11 A G 11: 58,978,637 D133G probably benign Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Copb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Copb1 APN 7 114226776 missense probably benign 0.00
IGL02458:Copb1 APN 7 114246785 missense probably benign 0.00
IGL02549:Copb1 APN 7 114246797 missense probably benign 0.00
IGL02639:Copb1 APN 7 114226595 splice site probably benign
robbers UTSW 7 114248976 missense probably damaging 1.00
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0012:Copb1 UTSW 7 114237408 missense probably damaging 0.99
R0023:Copb1 UTSW 7 114250094 missense probably benign 0.26
R0631:Copb1 UTSW 7 114233282 missense probably benign 0.12
R1996:Copb1 UTSW 7 114232203 missense probably benign 0.00
R2256:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R2257:Copb1 UTSW 7 114253875 missense possibly damaging 0.89
R3853:Copb1 UTSW 7 114223316 missense probably damaging 1.00
R4679:Copb1 UTSW 7 114248976 missense probably damaging 1.00
R4686:Copb1 UTSW 7 114221736 missense possibly damaging 0.94
R5057:Copb1 UTSW 7 114226762 missense probably benign
R5140:Copb1 UTSW 7 114246800 missense probably benign 0.01
R5669:Copb1 UTSW 7 114237585 missense probably damaging 1.00
R5779:Copb1 UTSW 7 114219572 missense probably damaging 1.00
R6017:Copb1 UTSW 7 114236797 missense probably benign 0.07
R6114:Copb1 UTSW 7 114246801 missense probably benign 0.00
R6403:Copb1 UTSW 7 114238451 missense probably damaging 1.00
R6826:Copb1 UTSW 7 114226719 missense probably benign 0.00
R6905:Copb1 UTSW 7 114253890 missense probably benign 0.00
R7241:Copb1 UTSW 7 114237356 missense probably damaging 0.96
R7293:Copb1 UTSW 7 114219602 missense probably damaging 1.00
R8103:Copb1 UTSW 7 114234967 missense possibly damaging 0.67
R8427:Copb1 UTSW 7 114226754 missense probably benign 0.03
R8690:Copb1 UTSW 7 114250228 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCATTTGTTGAAGATGCTTCCTTT -3'
(R):5'- CATGAGCCCATGTGGTTGCT -3'

Sequencing Primer
(F):5'- GGGTCTTTGATTCACTGATCAAC -3'
(R):5'- GTTTTATATCTGGGGAAAAGTG -3'
Posted On2019-10-07