Incidental Mutation 'R7485:Pkd1l1'
ID580094
Institutional Source Beutler Lab
Gene Symbol Pkd1l1
Ensembl Gene ENSMUSG00000046634
Gene Namepolycystic kidney disease 1 like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7485 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location8826708-8973266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8965148 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 131 (V131L)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000120803
Gene: ENSMUSG00000046634
AA Change: V131L

DomainStartEndE-ValueType
low complexity region 172 184 N/A INTRINSIC
PKD 205 287 2.9e0 SMART
PKD 291 369 1.42e-9 SMART
Pfam:REJ 398 1001 1.7e-45 PFAM
low complexity region 1208 1218 N/A INTRINSIC
GPS 1370 1413 1.21e-1 SMART
transmembrane domain 1434 1451 N/A INTRINSIC
LH2 1479 1598 2.94e-3 SMART
transmembrane domain 1640 1659 N/A INTRINSIC
transmembrane domain 1679 1701 N/A INTRINSIC
transmembrane domain 1817 1839 N/A INTRINSIC
transmembrane domain 1854 1876 N/A INTRINSIC
Pfam:PKD_channel 2109 2339 1.5e-23 PFAM
transmembrane domain 2381 2403 N/A INTRINSIC
low complexity region 2436 2449 N/A INTRINSIC
low complexity region 2458 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.3023 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family containing 11 transmembrane domains, a receptor for egg jelly (REJ) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. The encoded protein may play a role in the male reproductive system. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU induced point mutation display lethality throughout fetal growth and development with abnormalities in left right patterning and heterotaxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Copb1 A C 7: 114,245,485 I213S possibly damaging Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Fbln2 A G 6: 91,270,161 probably null Het
Fbn2 T C 18: 58,071,840 D1177G possibly damaging Het
Fbxl6 T C 15: 76,537,913 probably null Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Naip6 T C 13: 100,283,851 K1304E probably benign Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Sgsm1 A T 5: 113,279,635 probably null Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Trim11 A G 11: 58,978,637 D133G probably benign Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Pkd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pkd1l1 APN 11 8961971 missense unknown
IGL00156:Pkd1l1 APN 11 8950515 missense probably damaging 1.00
IGL00161:Pkd1l1 APN 11 8929353 critical splice donor site probably null
IGL00489:Pkd1l1 APN 11 8834773 critical splice donor site probably null
IGL00495:Pkd1l1 APN 11 8868493 missense probably benign 0.34
IGL00983:Pkd1l1 APN 11 8844585 missense probably benign
IGL01071:Pkd1l1 APN 11 8848921 missense probably benign 0.00
IGL01093:Pkd1l1 APN 11 8901345 missense probably benign 0.06
IGL01295:Pkd1l1 APN 11 8933685 missense possibly damaging 0.93
IGL01311:Pkd1l1 APN 11 8901174 missense possibly damaging 0.53
IGL01412:Pkd1l1 APN 11 8950409 missense possibly damaging 0.73
IGL01978:Pkd1l1 APN 11 8961336 missense unknown
IGL01999:Pkd1l1 APN 11 8836291 missense probably benign
IGL02080:Pkd1l1 APN 11 8961345 missense unknown
IGL02106:Pkd1l1 APN 11 8833800 missense probably damaging 1.00
IGL02216:Pkd1l1 APN 11 8834897 missense probably damaging 0.96
IGL02305:Pkd1l1 APN 11 8902467 missense probably benign
IGL02337:Pkd1l1 APN 11 8942079 missense probably damaging 1.00
IGL02576:Pkd1l1 APN 11 8844560 missense possibly damaging 0.61
IGL02704:Pkd1l1 APN 11 8834910 missense probably benign 0.00
IGL02814:Pkd1l1 APN 11 8902582 missense probably benign 0.01
IGL02904:Pkd1l1 APN 11 8868450 splice site probably benign
IGL02972:Pkd1l1 APN 11 8863908 missense probably damaging 0.99
IGL03091:Pkd1l1 APN 11 8855564 missense probably damaging 1.00
IGL03113:Pkd1l1 APN 11 8834793 missense probably benign 0.20
IGL03210:Pkd1l1 APN 11 8965127 missense unknown
PIT4581001:Pkd1l1 UTSW 11 8916298 frame shift probably null
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0020:Pkd1l1 UTSW 11 8875765 splice site probably benign
R0496:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
R0547:Pkd1l1 UTSW 11 8836448 splice site probably benign
R0582:Pkd1l1 UTSW 11 8931699 splice site probably benign
R0761:Pkd1l1 UTSW 11 8854375 missense probably damaging 1.00
R0969:Pkd1l1 UTSW 11 8936898 missense probably damaging 1.00
R1348:Pkd1l1 UTSW 11 8834806 missense probably benign 0.18
R1366:Pkd1l1 UTSW 11 8941038 splice site probably benign
R1401:Pkd1l1 UTSW 11 8854487 nonsense probably null
R1444:Pkd1l1 UTSW 11 8854386 missense probably damaging 1.00
R1445:Pkd1l1 UTSW 11 8870313 missense probably benign 0.00
R1463:Pkd1l1 UTSW 11 8916302 missense probably damaging 1.00
R1496:Pkd1l1 UTSW 11 8941077 missense possibly damaging 0.95
R1542:Pkd1l1 UTSW 11 8874179 missense possibly damaging 0.82
R1543:Pkd1l1 UTSW 11 8901200 missense probably damaging 1.00
R1619:Pkd1l1 UTSW 11 8950413 missense probably damaging 0.98
R1875:Pkd1l1 UTSW 11 8844670 splice site probably benign
R1929:Pkd1l1 UTSW 11 8836197 splice site probably benign
R1958:Pkd1l1 UTSW 11 8874161 missense probably benign 0.01
R2223:Pkd1l1 UTSW 11 8889063 missense probably benign 0.18
R2223:Pkd1l1 UTSW 11 8950422 missense probably benign
R2264:Pkd1l1 UTSW 11 8879112 missense probably damaging 0.97
R2349:Pkd1l1 UTSW 11 8826819 splice site probably null
R2431:Pkd1l1 UTSW 11 8947197 missense probably damaging 0.99
R2483:Pkd1l1 UTSW 11 8962701 missense probably damaging 1.00
R2517:Pkd1l1 UTSW 11 8958900 missense unknown
R2888:Pkd1l1 UTSW 11 8947251 missense probably damaging 1.00
R2965:Pkd1l1 UTSW 11 8874236 missense probably damaging 1.00
R3123:Pkd1l1 UTSW 11 8973021 missense unknown
R3153:Pkd1l1 UTSW 11 8867207 missense probably benign 0.01
R3840:Pkd1l1 UTSW 11 8889050 missense probably damaging 1.00
R3855:Pkd1l1 UTSW 11 8965047 critical splice donor site probably null
R3880:Pkd1l1 UTSW 11 8961983 missense unknown
R3970:Pkd1l1 UTSW 11 8874218 missense probably damaging 1.00
R4195:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4196:Pkd1l1 UTSW 11 8909929 missense probably damaging 1.00
R4246:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4247:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4249:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4250:Pkd1l1 UTSW 11 8865543 missense possibly damaging 0.51
R4593:Pkd1l1 UTSW 11 8901253 missense probably damaging 0.97
R4609:Pkd1l1 UTSW 11 8958964 missense unknown
R4797:Pkd1l1 UTSW 11 8961340 missense unknown
R4910:Pkd1l1 UTSW 11 8929360 missense possibly damaging 0.50
R4940:Pkd1l1 UTSW 11 8844585 missense probably benign
R5084:Pkd1l1 UTSW 11 8942004 missense probably benign 0.05
R5147:Pkd1l1 UTSW 11 8849003 missense possibly damaging 0.71
R5360:Pkd1l1 UTSW 11 8879204 missense probably benign
R5483:Pkd1l1 UTSW 11 8901141 critical splice donor site probably null
R5604:Pkd1l1 UTSW 11 8833877 missense probably damaging 0.98
R5642:Pkd1l1 UTSW 11 8879202 missense probably damaging 1.00
R5652:Pkd1l1 UTSW 11 8909889 missense probably benign 0.03
R5751:Pkd1l1 UTSW 11 8867204 missense possibly damaging 0.45
R5761:Pkd1l1 UTSW 11 8916301 missense probably damaging 1.00
R5800:Pkd1l1 UTSW 11 8861302 missense probably benign
R5874:Pkd1l1 UTSW 11 8908688 missense probably damaging 1.00
R5897:Pkd1l1 UTSW 11 8879176 missense probably benign 0.03
R5913:Pkd1l1 UTSW 11 8863849 missense probably benign 0.00
R5930:Pkd1l1 UTSW 11 8958969 missense unknown
R6000:Pkd1l1 UTSW 11 8950427 missense probably benign 0.00
R6005:Pkd1l1 UTSW 11 8857113 missense probably damaging 1.00
R6013:Pkd1l1 UTSW 11 8869452 splice site probably null
R6027:Pkd1l1 UTSW 11 8916272 nonsense probably null
R6028:Pkd1l1 UTSW 11 8836267 missense probably benign 0.06
R6129:Pkd1l1 UTSW 11 8868543 missense probably benign 0.00
R6182:Pkd1l1 UTSW 11 8865555 missense probably benign 0.36
R6226:Pkd1l1 UTSW 11 8901287 missense probably benign 0.00
R6257:Pkd1l1 UTSW 11 8942195 missense probably benign 0.22
R6340:Pkd1l1 UTSW 11 8844649 missense probably benign 0.09
R6478:Pkd1l1 UTSW 11 8863911 missense probably benign 0.00
R6558:Pkd1l1 UTSW 11 8889052 missense probably benign 0.00
R6750:Pkd1l1 UTSW 11 8973217 missense unknown
R6987:Pkd1l1 UTSW 11 8902575 missense probably benign 0.01
R6996:Pkd1l1 UTSW 11 8849046 missense probably damaging 1.00
R7139:Pkd1l1 UTSW 11 8890737 missense
R7224:Pkd1l1 UTSW 11 8945241 missense
R7244:Pkd1l1 UTSW 11 8871771 missense
R7265:Pkd1l1 UTSW 11 8929402 missense
R7358:Pkd1l1 UTSW 11 8945202 missense
R7387:Pkd1l1 UTSW 11 8901203 missense
R7414:Pkd1l1 UTSW 11 8916267 missense
R7459:Pkd1l1 UTSW 11 8902428 missense
R7478:Pkd1l1 UTSW 11 8929441 missense
R7490:Pkd1l1 UTSW 11 8916265 missense
R7644:Pkd1l1 UTSW 11 8875758 missense
R7647:Pkd1l1 UTSW 11 8947296 missense
R7676:Pkd1l1 UTSW 11 8962708 missense
R7687:Pkd1l1 UTSW 11 8854390 missense
R8052:Pkd1l1 UTSW 11 8947315 missense
X0024:Pkd1l1 UTSW 11 8950413 missense probably benign 0.01
X0063:Pkd1l1 UTSW 11 8929430 missense probably damaging 0.96
X0065:Pkd1l1 UTSW 11 8909921 missense probably benign 0.10
Z1176:Pkd1l1 UTSW 11 8826801 missense
Z1177:Pkd1l1 UTSW 11 8945208 missense
Predicted Primers PCR Primer
(F):5'- CAACTAAAGAGGAGTCTGGCTAC -3'
(R):5'- AGCTAGCTGTTCTGAGATTAGC -3'

Sequencing Primer
(F):5'- TACGTGTGCCGCACAGATCTG -3'
(R):5'- ATGAGCTCAAGGCTGTTG -3'
Posted On2019-10-07