Incidental Mutation 'R7485:Trim11'
ID580096
Institutional Source Beutler Lab
Gene Symbol Trim11
Ensembl Gene ENSMUSG00000020455
Gene Nametripartite motif-containing 11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7485 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58978093-58991458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58978637 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000104438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093061] [ENSMUST00000108809] [ENSMUST00000108810]
Predicted Effect probably benign
Transcript: ENSMUST00000093061
AA Change: D133G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090749
Gene: ENSMUSG00000020455
AA Change: D133G

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 285 337 4.1e-24 SMART
SPRY 338 457 2.58e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108809
AA Change: D133G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104437
Gene: ENSMUSG00000020455
AA Change: D133G

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108810
AA Change: D133G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104438
Gene: ENSMUSG00000020455
AA Change: D133G

DomainStartEndE-ValueType
RING 16 56 3.05e-9 SMART
BBOX 87 127 5.81e-6 SMART
coiled coil region 137 207 N/A INTRINSIC
PRY 301 353 4.1e-24 SMART
SPRY 354 473 2.58e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nucleus and the cytoplasm. Its function has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Copb1 A C 7: 114,245,485 I213S possibly damaging Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Fbln2 A G 6: 91,270,161 probably null Het
Fbn2 T C 18: 58,071,840 D1177G possibly damaging Het
Fbxl6 T C 15: 76,537,913 probably null Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Naip6 T C 13: 100,283,851 K1304E probably benign Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Pkd1l1 C A 11: 8,965,148 V131L Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Sgsm1 A T 5: 113,279,635 probably null Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Trim11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Trim11 APN 11 58990697 missense probably benign
R0453:Trim11 UTSW 11 58990535 missense probably damaging 1.00
R0565:Trim11 UTSW 11 58990584 missense probably damaging 1.00
R2061:Trim11 UTSW 11 58982063 missense probably damaging 1.00
R4783:Trim11 UTSW 11 58988924 missense probably null 1.00
R5004:Trim11 UTSW 11 58981338 critical splice donor site probably benign
R5847:Trim11 UTSW 11 58990593 missense probably damaging 1.00
R6027:Trim11 UTSW 11 58978463 missense possibly damaging 0.76
R6928:Trim11 UTSW 11 58988843 missense probably damaging 1.00
R7128:Trim11 UTSW 11 58978277 missense probably damaging 1.00
R7389:Trim11 UTSW 11 58990655 missense probably damaging 1.00
R7535:Trim11 UTSW 11 58982065 missense probably damaging 0.99
R7629:Trim11 UTSW 11 58978334 missense probably damaging 1.00
R7734:Trim11 UTSW 11 58978354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATTACTTCACCGACCC -3'
(R):5'- GTTTTCCCCAGAATGCACGTG -3'

Sequencing Primer
(F):5'- ACTGCGGCCACAACTTCTG -3'
(R):5'- CGTGCATCTCATCCTGGAATAAG -3'
Posted On2019-10-07