Incidental Mutation 'R7485:Naip6'
ID580105
Institutional Source Beutler Lab
Gene Symbol Naip6
Ensembl Gene ENSMUSG00000078942
Gene NameNLR family, apoptosis inhibitory protein 6
SynonymsBirc1f, Naip-rs4, Naip-rs4A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R7485 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location100281121-100317674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100283851 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1304 (K1304E)
Ref Sequence ENSEMBL: ENSMUSP00000041766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042220] [ENSMUST00000118574]
Predicted Effect probably benign
Transcript: ENSMUST00000042220
AA Change: K1304E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041766
Gene: ENSMUSG00000078942
AA Change: K1304E

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 7.6e-37 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118574
AA Change: K1304E

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112867
Gene: ENSMUSG00000078942
AA Change: K1304E

DomainStartEndE-ValueType
BIR 58 129 6.21e-20 SMART
BIR 157 229 8.04e-37 SMART
BIR 276 347 5.19e-31 SMART
Pfam:NACHT 464 618 2.5e-35 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: Closest sequence match is AF381772. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Copb1 A C 7: 114,245,485 I213S possibly damaging Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Fbln2 A G 6: 91,270,161 probably null Het
Fbn2 T C 18: 58,071,840 D1177G possibly damaging Het
Fbxl6 T C 15: 76,537,913 probably null Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Pkd1l1 C A 11: 8,965,148 V131L Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Sgsm1 A T 5: 113,279,635 probably null Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Trim11 A G 11: 58,978,637 D133G probably benign Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Naip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Naip6 APN 13 100316017 missense probably benign 0.03
IGL01123:Naip6 APN 13 100304438 missense probably benign 0.02
IGL01151:Naip6 APN 13 100299093 missense probably benign 0.00
IGL01382:Naip6 APN 13 100299856 missense possibly damaging 0.95
IGL01415:Naip6 APN 13 100303290 missense probably benign 0.17
IGL01654:Naip6 APN 13 100299345 missense probably benign 0.00
IGL01662:Naip6 APN 13 100300354 missense probably damaging 1.00
IGL01726:Naip6 APN 13 100303252 missense probably benign 0.02
IGL01810:Naip6 APN 13 100288095 splice site probably benign
IGL01867:Naip6 APN 13 100300312 missense probably benign 0.40
IGL01926:Naip6 APN 13 100300196 missense probably damaging 1.00
IGL01964:Naip6 APN 13 100298730 splice site probably benign
IGL02145:Naip6 APN 13 100296978 missense possibly damaging 0.77
IGL02160:Naip6 APN 13 100299425 missense probably benign 0.01
IGL02214:Naip6 APN 13 100316059 missense probably damaging 1.00
IGL02342:Naip6 APN 13 100303240 missense possibly damaging 0.69
IGL02568:Naip6 APN 13 100316272 missense probably damaging 1.00
IGL02573:Naip6 APN 13 100299471 nonsense probably null
IGL02680:Naip6 APN 13 100283748 missense probably benign
IGL02829:Naip6 APN 13 100300765 missense probably benign 0.11
IGL02833:Naip6 APN 13 100299613 missense probably damaging 1.00
IGL02851:Naip6 APN 13 100300660 missense probably benign 0.01
IGL02860:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL02886:Naip6 APN 13 100300476 missense possibly damaging 0.95
IGL03155:Naip6 APN 13 100316424 missense possibly damaging 0.62
R0032:Naip6 UTSW 13 100303237 missense probably benign 0.00
R0310:Naip6 UTSW 13 100308213 missense possibly damaging 0.72
R0437:Naip6 UTSW 13 100296924 missense possibly damaging 0.75
R0472:Naip6 UTSW 13 100302260 missense probably benign 0.02
R0560:Naip6 UTSW 13 100300600 missense probably benign 0.08
R0638:Naip6 UTSW 13 100300528 missense probably benign 0.00
R0792:Naip6 UTSW 13 100283766 missense possibly damaging 0.78
R0963:Naip6 UTSW 13 100316475 missense probably benign 0.11
R1102:Naip6 UTSW 13 100304415 missense possibly damaging 0.62
R1278:Naip6 UTSW 13 100300362 missense probably damaging 1.00
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1462:Naip6 UTSW 13 100300240 missense possibly damaging 0.64
R1544:Naip6 UTSW 13 100316475 missense probably benign
R1595:Naip6 UTSW 13 100299094 missense probably damaging 0.96
R1749:Naip6 UTSW 13 100308255 missense probably benign 0.03
R1838:Naip6 UTSW 13 100316136 missense probably damaging 0.99
R1863:Naip6 UTSW 13 100300559 missense probably benign 0.03
R1914:Naip6 UTSW 13 100299428 missense probably benign 0.13
R2001:Naip6 UTSW 13 100300729 missense probably benign 0.44
R2082:Naip6 UTSW 13 100304344 splice site probably null
R2143:Naip6 UTSW 13 100299859 missense probably damaging 1.00
R2174:Naip6 UTSW 13 100298987 missense probably benign
R2266:Naip6 UTSW 13 100283559 missense possibly damaging 0.46
R2284:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2285:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2286:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2351:Naip6 UTSW 13 100283661 missense probably damaging 1.00
R2363:Naip6 UTSW 13 100316420 missense possibly damaging 0.90
R2445:Naip6 UTSW 13 100300668 missense probably damaging 0.99
R2971:Naip6 UTSW 13 100300600 missense probably benign 0.08
R2975:Naip6 UTSW 13 100288187 missense probably damaging 1.00
R3081:Naip6 UTSW 13 100300453 missense probably benign
R3082:Naip6 UTSW 13 100316417 missense probably benign 0.00
R3122:Naip6 UTSW 13 100316523 missense probably benign 0.00
R3417:Naip6 UTSW 13 100300600 missense probably benign 0.08
R3943:Naip6 UTSW 13 100294739 missense probably benign 0.01
R3944:Naip6 UTSW 13 100294739 missense probably benign 0.01
R4080:Naip6 UTSW 13 100299307 missense probably damaging 1.00
R4166:Naip6 UTSW 13 100316149 missense probably benign 0.23
R4396:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4397:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4418:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4512:Naip6 UTSW 13 100300600 missense probably benign 0.08
R4670:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4671:Naip6 UTSW 13 100294731 critical splice donor site probably null
R4722:Naip6 UTSW 13 100307072 missense possibly damaging 0.72
R4811:Naip6 UTSW 13 100285791 missense probably damaging 1.00
R4900:Naip6 UTSW 13 100296969 missense probably damaging 0.99
R5162:Naip6 UTSW 13 100300600 missense probably benign 0.08
R5316:Naip6 UTSW 13 100283782 missense probably benign 0.00
R5403:Naip6 UTSW 13 100300077 missense probably benign 0.12
R5437:Naip6 UTSW 13 100303304 nonsense probably null
R5507:Naip6 UTSW 13 100298915 missense probably benign 0.01
R5631:Naip6 UTSW 13 100300138 missense probably benign 0.02
R5657:Naip6 UTSW 13 100300401 missense probably benign
R5684:Naip6 UTSW 13 100300380 missense probably damaging 1.00
R5786:Naip6 UTSW 13 100300216 missense probably benign
R5787:Naip6 UTSW 13 100300216 missense probably benign
R5788:Naip6 UTSW 13 100300216 missense probably benign
R5878:Naip6 UTSW 13 100299673 missense probably damaging 1.00
R5895:Naip6 UTSW 13 100315992 missense possibly damaging 0.90
R5898:Naip6 UTSW 13 100299321 missense possibly damaging 0.93
R6113:Naip6 UTSW 13 100299286 missense possibly damaging 0.96
R6141:Naip6 UTSW 13 100308233 missense possibly damaging 0.91
R6199:Naip6 UTSW 13 100300600 missense probably benign 0.08
R6321:Naip6 UTSW 13 100300401 missense probably benign
R6402:Naip6 UTSW 13 100300718 missense probably benign 0.30
R6435:Naip6 UTSW 13 100294741 missense probably benign 0.04
R6477:Naip6 UTSW 13 100316008 missense probably damaging 1.00
R6601:Naip6 UTSW 13 100283758 missense probably benign
R6638:Naip6 UTSW 13 100300401 missense probably benign
R6639:Naip6 UTSW 13 100300401 missense probably benign
R6804:Naip6 UTSW 13 100299167 missense probably benign
R6922:Naip6 UTSW 13 100302198 missense possibly damaging 0.88
R6975:Naip6 UTSW 13 100316265 missense probably damaging 1.00
R7050:Naip6 UTSW 13 100315499 missense probably damaging 1.00
R7135:Naip6 UTSW 13 100300419 missense probably damaging 1.00
R7140:Naip6 UTSW 13 100300200 missense possibly damaging 0.95
R7182:Naip6 UTSW 13 100316149 missense probably benign 0.23
R7196:Naip6 UTSW 13 100300158 missense probably benign 0.10
R7234:Naip6 UTSW 13 100315503 nonsense probably null
R7259:Naip6 UTSW 13 100304355 missense probably damaging 1.00
R7322:Naip6 UTSW 13 100299388 missense possibly damaging 0.94
R7332:Naip6 UTSW 13 100300701 missense possibly damaging 0.62
R7339:Naip6 UTSW 13 100316019 missense probably damaging 1.00
R7353:Naip6 UTSW 13 100299751 missense probably benign 0.00
R7597:Naip6 UTSW 13 100300600 missense probably benign 0.08
R7835:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7840:Naip6 UTSW 13 100315471 missense probably damaging 1.00
R7918:Naip6 UTSW 13 100316004 missense probably benign 0.19
R7923:Naip6 UTSW 13 100315471 missense probably damaging 1.00
R8082:Naip6 UTSW 13 100300401 missense probably benign
R8082:Naip6 UTSW 13 100300453 missense probably benign
R8103:Naip6 UTSW 13 100301343 missense probably benign 0.00
X0066:Naip6 UTSW 13 100315462 nonsense probably null
Z1177:Naip6 UTSW 13 100299417 missense probably benign 0.20
Z1177:Naip6 UTSW 13 100300800 missense probably damaging 1.00
Z1177:Naip6 UTSW 13 100316130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCCAGGAGCCAACTGAG -3'
(R):5'- ACCAGGCTGCTGTTTGATGC -3'

Sequencing Primer
(F):5'- GGAGCCAACTGAGCATCC -3'
(R):5'- CTCTAAAACATCATGTAGAGCATTCC -3'
Posted On2019-10-07