Incidental Mutation 'R0631:Pla2g6'
ID 58012
Institutional Source Beutler Lab
Gene Symbol Pla2g6
Ensembl Gene ENSMUSG00000042632
Gene Name phospholipase A2, group VI
Synonyms iPLA2, iPLA2beta
MMRRC Submission 038820-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0631 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 79170428-79212590 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79190596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 322 (H322L)
Ref Sequence ENSEMBL: ENSMUSP00000134672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047816] [ENSMUST00000166977] [ENSMUST00000172403] [ENSMUST00000173163] [ENSMUST00000174021] [ENSMUST00000173632]
AlphaFold P97819
Predicted Effect probably damaging
Transcript: ENSMUST00000047816
AA Change: H322L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044234
Gene: ENSMUSG00000042632
AA Change: H322L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166977
AA Change: H322L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132071
Gene: ENSMUSG00000042632
AA Change: H322L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172403
AA Change: H322L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131081
Gene: ENSMUSG00000042632
AA Change: H322L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173163
AA Change: H322L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134456
Gene: ENSMUSG00000042632
AA Change: H322L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Pfam:Patatin 427 611 6.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173601
Predicted Effect probably damaging
Transcript: ENSMUST00000174021
AA Change: H322L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134672
Gene: ENSMUSG00000042632
AA Change: H322L

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
ANK 185 215 4.6e0 SMART
ANK 219 248 3.23e-4 SMART
ANK 286 312 1.52e0 SMART
ANK 316 345 6.46e-4 SMART
ANK 349 378 2.02e-5 SMART
Blast:ANK 382 411 2e-8 BLAST
Pfam:Patatin 482 666 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174375
Predicted Effect probably benign
Transcript: ENSMUST00000173632
SMART Domains Protein: ENSMUSP00000133998
Gene: ENSMUSG00000042632

DomainStartEndE-ValueType
low complexity region 96 109 N/A INTRINSIC
ANK 151 181 2.97e-3 SMART
Blast:ANK 185 204 7e-6 BLAST
Meta Mutation Damage Score 0.9557 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an A2 phospholipase, a class of enzyme that catalyzes the release of fatty acids from phospholipids. The encoded protein may play a role in phospholipid remodelling, arachidonic acid release, leukotriene and prostaglandin synthesis, fas-mediated apoptosis, and transmembrane ion flux in glucose-stimulated B-cells. Several transcript variants encoding multiple isoforms have been described, but the full-length nature of only three of them have been determined to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display impaired male fertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,982,479 (GRCm39) probably benign Het
Afap1l2 T C 19: 56,904,517 (GRCm39) E594G probably benign Het
Ak8 T G 2: 28,625,677 (GRCm39) I240S probably damaging Het
Akap13 T C 7: 75,264,744 (GRCm39) V174A probably damaging Het
Alppl2 G A 1: 87,017,095 (GRCm39) T66I probably damaging Het
Ankrd61 T A 5: 143,831,697 (GRCm39) I36F probably damaging Het
Antxrl T A 14: 33,780,758 (GRCm39) probably null Het
Arhgef2 G C 3: 88,541,743 (GRCm39) V244L probably damaging Het
Arid1a A G 4: 133,416,481 (GRCm39) I1098T unknown Het
Atr T C 9: 95,756,830 (GRCm39) V903A possibly damaging Het
B3gnt6 C A 7: 97,842,899 (GRCm39) A354S probably benign Het
Bnc1 A T 7: 81,624,114 (GRCm39) I371N probably damaging Het
Camsap1 A T 2: 25,823,659 (GRCm39) S1464T probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Cass4 T C 2: 172,274,331 (GRCm39) I728T probably damaging Het
Ccdc88a A T 11: 29,443,752 (GRCm39) M1378L probably damaging Het
Ccdc9 C A 7: 16,012,384 (GRCm39) W266L probably damaging Het
Cct6b C A 11: 82,627,914 (GRCm39) probably null Het
Cd177 T C 7: 24,456,111 (GRCm39) E219G probably benign Het
Cdkal1 A T 13: 29,538,667 (GRCm39) Y497* probably null Het
Chmp2a T C 7: 12,766,371 (GRCm39) E107G probably damaging Het
Chrna2 T G 14: 66,386,757 (GRCm39) V301G probably benign Het
Chrna7 A G 7: 62,749,391 (GRCm39) C364R probably benign Het
Cltc G T 11: 86,603,439 (GRCm39) L796I probably benign Het
Col12a1 T C 9: 79,610,658 (GRCm39) T249A probably damaging Het
Col13a1 G A 10: 61,723,129 (GRCm39) Q270* probably null Het
Col6a1 C T 10: 76,545,569 (GRCm39) V968M probably benign Het
Copb1 C A 7: 113,832,517 (GRCm39) V511F probably benign Het
Daw1 C G 1: 83,174,981 (GRCm39) S160R probably damaging Het
Ddx46 A G 13: 55,787,590 (GRCm39) probably benign Het
Depdc7 T C 2: 104,552,332 (GRCm39) K492E possibly damaging Het
Dmbt1 C T 7: 130,699,383 (GRCm39) A1004V possibly damaging Het
Dnah7b G A 1: 46,280,152 (GRCm39) V2694I probably benign Het
Dnhd1 T A 7: 105,300,831 (GRCm39) F63I probably benign Het
Edc4 C A 8: 106,617,424 (GRCm39) A1052E possibly damaging Het
Eif2s2 T A 2: 154,726,278 (GRCm39) K129M probably damaging Het
Emx2 A G 19: 59,452,460 (GRCm39) D248G probably damaging Het
Erich6b T C 14: 75,896,449 (GRCm39) probably benign Het
Exoc3l4 A G 12: 111,394,400 (GRCm39) K507E probably benign Het
Fanci T A 7: 79,055,953 (GRCm39) V195E probably damaging Het
Fgfr2 T G 7: 129,828,969 (GRCm39) probably benign Het
Frem1 A G 4: 82,890,402 (GRCm39) S1007P probably damaging Het
Fry T C 5: 150,419,817 (GRCm39) I993T possibly damaging Het
Fst A G 13: 114,591,038 (GRCm39) S244P possibly damaging Het
Gcc1 T C 6: 28,421,009 (GRCm39) T103A probably damaging Het
Gdf2 C T 14: 33,663,178 (GRCm39) P24L probably damaging Het
Gja3 T C 14: 57,274,219 (GRCm39) D51G possibly damaging Het
Gm10305 A G 4: 99,161,313 (GRCm39) D74G unknown Het
Gm12689 G T 4: 99,184,258 (GRCm39) G37V unknown Het
Gm5424 C T 10: 61,907,313 (GRCm39) noncoding transcript Het
Hephl1 T C 9: 14,995,820 (GRCm39) E434G probably benign Het
Hoatz T A 9: 51,013,253 (GRCm39) R6S probably benign Het
Htatip2 T C 7: 49,423,059 (GRCm39) C205R possibly damaging Het
Igf2r T C 17: 12,936,161 (GRCm39) probably null Het
Ints2 T C 11: 86,124,022 (GRCm39) I589V probably benign Het
Itgae T A 11: 73,005,733 (GRCm39) V299D probably damaging Het
Kcnma1 T C 14: 23,559,852 (GRCm39) probably benign Het
Kif11 A G 19: 37,401,565 (GRCm39) probably benign Het
Kif13a A G 13: 46,932,364 (GRCm39) probably benign Het
Kif18a T A 2: 109,128,667 (GRCm39) probably benign Het
Klhl29 T C 12: 5,144,883 (GRCm39) T406A probably benign Het
Litaf A T 16: 10,784,276 (GRCm39) probably benign Het
Lmntd1 T A 6: 145,375,726 (GRCm39) I71F probably benign Het
Lrit3 A C 3: 129,582,204 (GRCm39) C594W probably damaging Het
Lrp6 T A 6: 134,456,738 (GRCm39) Q842L possibly damaging Het
Lrrcc1 T A 3: 14,605,179 (GRCm39) probably benign Het
Macf1 A T 4: 123,349,317 (GRCm39) L1829* probably null Het
Mapk1ip1 T C 7: 138,437,684 (GRCm39) T249A possibly damaging Het
Mfap4 T C 11: 61,378,006 (GRCm39) F173L probably damaging Het
Mfsd9 C A 1: 40,829,634 (GRCm39) probably benign Het
Mgat4b T C 11: 50,121,590 (GRCm39) S69P probably damaging Het
Mki67 A T 7: 135,306,117 (GRCm39) V620D probably damaging Het
Moxd1 C T 10: 24,128,852 (GRCm39) T201I probably damaging Het
Msh4 G C 3: 153,572,057 (GRCm39) D774E probably benign Het
Myg1 C T 15: 102,240,284 (GRCm39) R37C probably benign Het
Myrf C A 19: 10,206,246 (GRCm39) A57S probably benign Het
Ndst1 G A 18: 60,833,431 (GRCm39) probably benign Het
Nedd4l A T 18: 65,341,574 (GRCm39) probably benign Het
Neil2 T A 14: 63,420,849 (GRCm39) I281F possibly damaging Het
Nfatc2 T A 2: 168,432,035 (GRCm39) D26V probably benign Het
Nt5c A G 11: 115,381,540 (GRCm39) probably null Het
Or13a24 T G 7: 140,154,420 (GRCm39) M118R probably damaging Het
Or2w1b G T 13: 21,300,078 (GRCm39) C72F probably damaging Het
Or2z8 T A 8: 72,812,166 (GRCm39) I214N probably damaging Het
Or5ac20 A G 16: 59,104,570 (GRCm39) C97R possibly damaging Het
Or5t15 T C 2: 86,681,311 (GRCm39) T244A probably benign Het
Ovch2 A G 7: 107,381,228 (GRCm39) S557P probably benign Het
Pik3cg A G 12: 32,255,202 (GRCm39) S262P probably benign Het
Plch1 A T 3: 63,606,640 (GRCm39) L1079Q probably benign Het
Plekhg4 T A 8: 106,105,934 (GRCm39) V777D probably damaging Het
Plekhg5 A G 4: 152,196,876 (GRCm39) D747G possibly damaging Het
Poln C A 5: 34,276,302 (GRCm39) V318F possibly damaging Het
Pou5f2 T A 13: 78,173,873 (GRCm39) S272T probably benign Het
Ppp1r3e T G 14: 55,114,073 (GRCm39) S200R possibly damaging Het
Prl7d1 G A 13: 27,894,165 (GRCm39) P135S probably benign Het
Ptgs2 G A 1: 149,980,288 (GRCm39) V409I probably benign Het
Ptk2b T C 14: 66,415,200 (GRCm39) T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 (GRCm39) T747A probably damaging Het
Qrfpr A G 3: 36,276,138 (GRCm39) I84T probably damaging Het
Rab44 A G 17: 29,358,118 (GRCm39) D102G possibly damaging Het
Rimoc1 A G 15: 4,015,971 (GRCm39) probably benign Het
Rnf125 A T 18: 21,112,140 (GRCm39) D57V possibly damaging Het
Rnf145 T C 11: 44,450,851 (GRCm39) F392L probably damaging Het
Rttn A G 18: 89,007,670 (GRCm39) N435S probably benign Het
Scn8a A G 15: 100,933,418 (GRCm39) T1500A probably damaging Het
Sgsm1 A G 5: 113,432,989 (GRCm39) probably benign Het
Sgsm3 A T 15: 80,895,937 (GRCm39) *751C probably null Het
Slc35c2 A C 2: 165,122,849 (GRCm39) L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 (GRCm38) E396V probably damaging Het
Smarca4 G C 9: 21,570,280 (GRCm39) probably benign Het
Snapc3 T A 4: 83,336,039 (GRCm39) V17D probably damaging Het
Snta1 G T 2: 154,218,992 (GRCm39) Q448K probably benign Het
Sptbn2 A G 19: 4,790,014 (GRCm39) D1334G probably benign Het
Stard5 A G 7: 83,281,965 (GRCm39) R41G probably damaging Het
Stxbp5 T A 10: 9,660,102 (GRCm39) N731I probably benign Het
Tmem135 T A 7: 88,792,996 (GRCm39) K413* probably null Het
Tmem38a G A 8: 73,333,862 (GRCm39) V114I probably benign Het
Tpr A G 1: 150,298,282 (GRCm39) T1057A probably damaging Het
Ttc23l A T 15: 10,540,066 (GRCm39) L139Q probably damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Tuba3b A G 6: 145,565,302 (GRCm39) T257A probably damaging Het
Tubgcp6 A C 15: 88,985,190 (GRCm39) Y1633D probably damaging Het
Txnl1 C T 18: 63,804,644 (GRCm39) probably benign Het
Unc13b A G 4: 43,182,849 (GRCm39) Q3186R possibly damaging Het
Vmn2r75 T A 7: 85,812,478 (GRCm39) S514C probably null Het
Whrn G A 4: 63,337,726 (GRCm39) T545I probably damaging Het
Zdhhc20 T C 14: 58,095,097 (GRCm39) H154R probably damaging Het
Zfp462 A T 4: 55,007,563 (GRCm39) M1L possibly damaging Het
Zfp831 A G 2: 174,487,083 (GRCm39) K586R possibly damaging Het
Zfp990 A T 4: 145,263,872 (GRCm39) H290L possibly damaging Het
Zfpm1 C T 8: 123,063,613 (GRCm39) probably benign Het
Other mutations in Pla2g6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Pla2g6 APN 15 79,173,441 (GRCm39) missense probably damaging 0.96
IGL00906:Pla2g6 APN 15 79,171,947 (GRCm39) missense probably damaging 1.00
IGL01432:Pla2g6 APN 15 79,202,168 (GRCm39) start codon destroyed probably null 1.00
IGL01640:Pla2g6 APN 15 79,188,513 (GRCm39) missense probably benign
IGL01715:Pla2g6 APN 15 79,202,057 (GRCm39) missense probably benign 0.00
IGL01943:Pla2g6 APN 15 79,197,316 (GRCm39) missense probably null 0.00
IGL02551:Pla2g6 APN 15 79,183,294 (GRCm39) missense possibly damaging 0.95
IGL03120:Pla2g6 APN 15 79,171,060 (GRCm39) missense probably damaging 1.00
IGL03193:Pla2g6 APN 15 79,201,985 (GRCm39) missense probably damaging 0.98
IGL03194:Pla2g6 APN 15 79,201,985 (GRCm39) missense probably damaging 0.98
IGL03205:Pla2g6 APN 15 79,201,985 (GRCm39) missense probably damaging 0.98
IGL03289:Pla2g6 APN 15 79,201,985 (GRCm39) missense probably damaging 0.98
R0288:Pla2g6 UTSW 15 79,171,106 (GRCm39) splice site probably benign
R1216:Pla2g6 UTSW 15 79,190,635 (GRCm39) missense probably benign 0.18
R1617:Pla2g6 UTSW 15 79,173,341 (GRCm39) missense probably benign 0.03
R1785:Pla2g6 UTSW 15 79,190,545 (GRCm39) missense probably benign 0.02
R2025:Pla2g6 UTSW 15 79,170,964 (GRCm39) missense probably damaging 1.00
R2079:Pla2g6 UTSW 15 79,197,194 (GRCm39) missense probably damaging 1.00
R3952:Pla2g6 UTSW 15 79,197,296 (GRCm39) missense probably damaging 1.00
R4774:Pla2g6 UTSW 15 79,171,818 (GRCm39) missense probably damaging 1.00
R4826:Pla2g6 UTSW 15 79,192,879 (GRCm39) missense possibly damaging 0.96
R5093:Pla2g6 UTSW 15 79,171,328 (GRCm39) missense probably benign 0.12
R5327:Pla2g6 UTSW 15 79,186,837 (GRCm39) missense probably benign 0.03
R5390:Pla2g6 UTSW 15 79,173,893 (GRCm39) missense possibly damaging 0.72
R5419:Pla2g6 UTSW 15 79,183,342 (GRCm39) missense possibly damaging 0.82
R5432:Pla2g6 UTSW 15 79,186,817 (GRCm39) critical splice donor site probably null
R5633:Pla2g6 UTSW 15 79,183,342 (GRCm39) missense possibly damaging 0.82
R5829:Pla2g6 UTSW 15 79,171,893 (GRCm39) missense possibly damaging 0.73
R5930:Pla2g6 UTSW 15 79,187,728 (GRCm39) intron probably benign
R6228:Pla2g6 UTSW 15 79,189,924 (GRCm39) missense probably benign 0.00
R6241:Pla2g6 UTSW 15 79,188,592 (GRCm39) missense probably benign 0.02
R6339:Pla2g6 UTSW 15 79,193,016 (GRCm39) missense probably damaging 0.99
R6485:Pla2g6 UTSW 15 79,191,572 (GRCm39) missense probably benign 0.00
R6754:Pla2g6 UTSW 15 79,190,510 (GRCm39) missense probably benign 0.01
R7419:Pla2g6 UTSW 15 79,189,898 (GRCm39) splice site probably null
R7425:Pla2g6 UTSW 15 79,192,933 (GRCm39) missense probably damaging 1.00
R7710:Pla2g6 UTSW 15 79,171,358 (GRCm39) missense probably damaging 0.98
R7738:Pla2g6 UTSW 15 79,181,633 (GRCm39) nonsense probably null
R7768:Pla2g6 UTSW 15 79,181,514 (GRCm39) missense probably damaging 1.00
R7796:Pla2g6 UTSW 15 79,202,025 (GRCm39) missense probably benign 0.32
R8184:Pla2g6 UTSW 15 79,171,322 (GRCm39) missense probably benign 0.02
R8359:Pla2g6 UTSW 15 79,171,370 (GRCm39) missense probably damaging 0.98
R9105:Pla2g6 UTSW 15 79,183,397 (GRCm39) critical splice acceptor site probably null
R9280:Pla2g6 UTSW 15 79,197,314 (GRCm39) missense probably benign 0.09
R9471:Pla2g6 UTSW 15 79,202,039 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTCCTAACAAACCAGCGGC -3'
(R):5'- GCTTGGATACCGTGAAAGACCCTG -3'

Sequencing Primer
(F):5'- ACACCCCTACCGTGGAG -3'
(R):5'- ATGACCTCAGGAGTCAGTGC -3'
Posted On 2013-07-11