Incidental Mutation 'R7485:Fbn2'
ID580123
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R7485 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58071840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1177 (D1177G)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025497
AA Change: D1177G

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: D1177G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C A 7: 131,228,833 P332Q probably damaging Het
Adat3 C T 10: 80,606,400 A24V probably benign Het
Agbl1 A T 7: 76,589,493 E832D unknown Het
Akap8l G A 17: 32,335,571 S347L probably benign Het
Ankmy1 G T 1: 92,876,657 A868E probably damaging Het
Ankrd49 A T 9: 14,782,541 L110* probably null Het
Aoc3 A G 11: 101,337,403 T679A probably damaging Het
Ap1s3 A G 1: 79,614,301 Y111H probably damaging Het
Arnt T A 3: 95,495,348 N777K probably damaging Het
Atp4b A T 8: 13,386,732 M260K probably benign Het
Bcl2l15 A T 3: 103,833,413 D65V probably damaging Het
Bicdl1 G T 5: 115,663,786 S340* probably null Het
Ccdc15 T C 9: 37,315,278 R467G probably benign Het
Ccdc68 T A 18: 69,969,013 M327K possibly damaging Het
Ccdc83 T C 7: 90,223,930 T406A probably benign Het
Ccnf A T 17: 24,249,258 V55D probably damaging Het
Cldn12 A G 5: 5,508,008 F140L probably benign Het
Copb1 A C 7: 114,245,485 I213S possibly damaging Het
Cps1 G A 1: 67,139,857 G76D probably damaging Het
Ctrc A G 4: 141,840,316 W159R probably damaging Het
Cul4a C T 8: 13,140,279 T572M possibly damaging Het
Cyp2c40 A T 19: 39,807,606 Y109* probably null Het
Dcc A G 18: 71,420,246 Y780H probably benign Het
Dctn1 C T 6: 83,189,905 A283V possibly damaging Het
Dio1 T C 4: 107,297,677 D134G probably benign Het
Dlg5 A T 14: 24,148,322 D1514E probably benign Het
Dlg5 A T 14: 24,177,839 L338Q probably damaging Het
Dlgap2 A T 8: 14,829,952 K767N probably damaging Het
Dst A T 1: 34,274,189 I4346F probably benign Het
Dzip1l T C 9: 99,661,012 F507L probably benign Het
Erich2 A T 2: 70,531,765 D300V probably damaging Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fam131a C T 16: 20,701,694 A299V probably benign Het
Frem3 A T 8: 80,613,336 I753F probably damaging Het
Gfra1 A G 19: 58,300,312 S234P probably damaging Het
Gm5065 C T 7: 5,359,441 R24C probably benign Het
Gtse1 T A 15: 85,868,700 S339T probably benign Het
Hdgfl3 T C 7: 81,900,358 N76S probably benign Het
Herc6 A G 6: 57,581,104 E23G probably benign Het
Hid1 T A 11: 115,354,719 H420L probably damaging Het
Igsf21 G A 4: 140,027,738 T440I probably benign Het
Ikzf4 T A 10: 128,632,582 H676L unknown Het
Il18r1 A G 1: 40,480,980 E177G probably benign Het
Iqch A G 9: 63,508,317 Y558H possibly damaging Het
Kif11 A T 19: 37,410,624 N752I possibly damaging Het
Kntc1 T A 5: 123,786,956 C1111S possibly damaging Het
Krtap9-5 A G 11: 99,948,974 K167R unknown Het
Lipe G T 7: 25,380,611 T704K probably benign Het
Lrrc32 A T 7: 98,498,207 I65F possibly damaging Het
Mogs C T 6: 83,116,207 H179Y probably damaging Het
Mtnr1b A T 9: 15,863,294 Y156* probably null Het
Mtus1 T C 8: 41,084,553 H42R probably benign Het
Mx2 T A 16: 97,545,718 D128E probably benign Het
Myof A T 19: 37,951,491 L829* probably null Het
Naip6 T C 13: 100,283,851 K1304E probably benign Het
Neo1 A C 9: 58,884,543 S1307R probably benign Het
Nipbl A T 15: 8,330,295 D1475E probably benign Het
Nlrp9b T A 7: 20,023,950 F371I probably damaging Het
Nrip1 A T 16: 76,291,450 M1073K probably damaging Het
Obox6 T C 7: 15,833,938 N195D probably damaging Het
Olfr1451 C T 19: 12,999,558 H191Y probably benign Het
Olfr206 A T 16: 59,345,324 C126S probably damaging Het
Olfr347 T A 2: 36,734,638 F106I probably benign Het
Olfr46 T A 7: 140,610,178 I4K probably benign Het
Olfr488 C A 7: 108,255,838 C100F probably damaging Het
Pax7 T C 4: 139,784,569 K232E probably benign Het
Phldb3 C T 7: 24,611,264 probably benign Het
Pkd1l1 C A 11: 8,965,148 V131L Het
Ppp2r5a A G 1: 191,396,335 S28P probably benign Het
Prl8a1 A G 13: 27,574,085 S214P probably damaging Het
Prmt2 A T 10: 76,221,004 C228* probably null Het
Prpf8 C T 11: 75,508,912 R2266* probably null Het
Rabl6 A G 2: 25,584,141 S648P unknown Het
Ralgapa1 T C 12: 55,712,672 K1022R probably damaging Het
Ralgapb T A 2: 158,443,355 D591E probably benign Het
Rprd1a A G 18: 24,506,832 probably null Het
Rsu1 T C 2: 13,216,875 R165G probably damaging Het
Samd8 A G 14: 21,792,423 E334G probably benign Het
Scn9a T A 2: 66,534,217 Q804L probably damaging Het
Sez6 A G 11: 77,973,885 D557G probably benign Het
Slc17a3 T A 13: 23,855,849 M290K Het
Snd1 T A 6: 28,531,450 V330E probably benign Het
Tceanc2 T C 4: 107,165,655 K45R probably damaging Het
Tg A T 15: 66,696,588 I1375F probably benign Het
Tmem116 T A 5: 121,495,061 I357K Het
Tmem39a G T 16: 38,588,296 R407L possibly damaging Het
Tmem74 A T 15: 43,867,365 M94K probably benign Het
Tpp1 C T 7: 105,749,544 C226Y probably damaging Het
Trbv21 T C 6: 41,202,927 I59T not run Het
Trim11 A G 11: 58,978,637 D133G probably benign Het
Uaca G A 9: 60,846,000 V76I probably damaging Het
Ugt2a3 A G 5: 87,327,680 probably null Het
Vmn2r104 G T 17: 20,029,475 H845N probably benign Het
Wdr24 T C 17: 25,826,127 Y279H probably damaging Het
Zbtb46 A G 2: 181,423,719 S213P probably benign Het
Zdhhc13 C A 7: 48,811,355 Y346* probably null Het
Zfp280b A T 10: 76,039,241 H318L probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
R7199:Fbn2 UTSW 18 58053761 nonsense probably null
R7219:Fbn2 UTSW 18 58053027 missense probably benign 0.04
R7226:Fbn2 UTSW 18 58037070 missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58066116 missense probably benign 0.14
R7414:Fbn2 UTSW 18 58096050 missense probably damaging 1.00
R7523:Fbn2 UTSW 18 58066080 missense probably benign 0.01
R7549:Fbn2 UTSW 18 58020464 nonsense probably null
R7619:Fbn2 UTSW 18 58080227 missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58105136 missense probably damaging 1.00
R7789:Fbn2 UTSW 18 58039313 missense probably benign 0.22
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAGAGGTCTTTCCATG -3'
(R):5'- GCACATACCTACCTTCTAACGG -3'

Sequencing Primer
(F):5'- TTTCCATGGAAAGCAGCCCAG -3'
(R):5'- GGCCCTTCTCCCATACTAGATGTG -3'
Posted On2019-10-07