Incidental Mutation 'R7486:Ercc5'
ID 580131
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7486 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 44148064 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214] [ENSMUST00000035991] [ENSMUST00000114709]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027214
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: M1K

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035991
SMART Domains Protein: ENSMUSP00000041964
Gene: ENSMUSG00000041684

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114709
SMART Domains Protein: ENSMUSP00000110357
Gene: ENSMUSG00000041684

DomainStartEndE-ValueType
low complexity region 117 129 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Blast:XPGN 456 501 3e-11 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTCCGCTGTTCTTTCGGG -3'
(R):5'- CCTGCACTCTAGATAGACAGAC -3'

Sequencing Primer
(F):5'- GAGACCGGGTCCGCTCC -3'
(R):5'- TCTAGATAGACAGACACCCAATCG -3'
Posted On 2019-10-07