Incidental Mutation 'R7486:Dnah7b'
ID580132
Institutional Source Beutler Lab
Gene Symbol Dnah7b
Ensembl Gene ENSMUSG00000041144
Gene Namedynein, axonemal, heavy chain 7B
SynonymsDnahc7b, LOC227058
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R7486 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location46066315-46373546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46290734 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 3246 (G3246D)
Ref Sequence ENSEMBL: ENSMUSP00000068738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069293]
Predicted Effect probably damaging
Transcript: ENSMUST00000069293
AA Change: G3246D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: G3246D

DomainStartEndE-ValueType
coiled coil region 760 790 N/A INTRINSIC
Pfam:DHC_N2 800 1209 3.7e-150 PFAM
AAA 1364 1503 3.24e-1 SMART
AAA 2012 2160 5.39e-2 SMART
Pfam:AAA_8 2347 2618 2.4e-75 PFAM
Pfam:MT 2630 2979 2.6e-54 PFAM
Pfam:AAA_9 3001 3226 2.3e-98 PFAM
Pfam:Dynein_heavy 3362 4064 8.4e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Dnah7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Dnah7b APN 1 46142149 missense probably benign 0.04
IGL00796:Dnah7b APN 1 46211337 missense probably damaging 0.96
IGL00825:Dnah7b APN 1 46224651 missense probably damaging 1.00
IGL00910:Dnah7b APN 1 46066729 unclassified probably benign
IGL00950:Dnah7b APN 1 46214322 missense probably benign 0.07
IGL01142:Dnah7b APN 1 46195378 critical splice donor site probably null
IGL01350:Dnah7b APN 1 46081432 splice site probably benign
IGL01392:Dnah7b APN 1 46126788 missense probably damaging 1.00
IGL01403:Dnah7b APN 1 46116300 splice site probably benign
IGL01460:Dnah7b APN 1 46139704 missense possibly damaging 0.82
IGL01576:Dnah7b APN 1 46268653 missense probably damaging 1.00
IGL01693:Dnah7b APN 1 46358147 missense probably benign 0.29
IGL01838:Dnah7b APN 1 46358137 nonsense probably null
IGL01906:Dnah7b APN 1 46175453 missense probably damaging 1.00
IGL01960:Dnah7b APN 1 46124337 splice site probably benign
IGL01989:Dnah7b APN 1 46289534 missense probably damaging 1.00
IGL02127:Dnah7b APN 1 46139875 missense probably benign
IGL02213:Dnah7b APN 1 46233592 missense probably damaging 0.97
IGL02267:Dnah7b APN 1 46226930 missense probably damaging 1.00
IGL02349:Dnah7b APN 1 46099503 nonsense probably null
IGL02381:Dnah7b APN 1 46277120 missense probably damaging 1.00
IGL02473:Dnah7b APN 1 46234193 missense probably damaging 1.00
IGL02484:Dnah7b APN 1 46195318 missense probably damaging 1.00
IGL02590:Dnah7b APN 1 46123777 missense probably benign 0.02
IGL02655:Dnah7b APN 1 46116301 splice site probably benign
IGL02704:Dnah7b APN 1 46142133 missense probably benign 0.03
IGL02719:Dnah7b APN 1 46099608 splice site probably benign
IGL02745:Dnah7b APN 1 46195029 splice site probably benign
IGL02818:Dnah7b APN 1 46290808 missense probably damaging 1.00
IGL02892:Dnah7b APN 1 46119298 missense possibly damaging 0.79
IGL03285:Dnah7b APN 1 46182375 missense probably benign 0.00
IGL03354:Dnah7b APN 1 46085689 missense probably damaging 1.00
IGL03355:Dnah7b APN 1 46119304 missense probably benign 0.18
PIT4305001:Dnah7b UTSW 1 46373348 missense probably damaging 1.00
R0116:Dnah7b UTSW 1 46213360 missense possibly damaging 0.94
R0145:Dnah7b UTSW 1 46223178 missense probably damaging 1.00
R0230:Dnah7b UTSW 1 46219348 missense probably damaging 1.00
R0302:Dnah7b UTSW 1 46123777 missense probably benign 0.26
R0313:Dnah7b UTSW 1 46207643 missense probably damaging 1.00
R0317:Dnah7b UTSW 1 46134656 missense probably damaging 1.00
R0347:Dnah7b UTSW 1 46240944 missense probably damaging 1.00
R0352:Dnah7b UTSW 1 46277126 missense probably damaging 0.98
R0363:Dnah7b UTSW 1 46236788 missense probably damaging 0.99
R0379:Dnah7b UTSW 1 46140176 missense probably benign 0.00
R0502:Dnah7b UTSW 1 46219544 missense probably damaging 0.96
R0602:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0631:Dnah7b UTSW 1 46240992 missense probably benign 0.02
R0664:Dnah7b UTSW 1 46324842 missense probably damaging 1.00
R0882:Dnah7b UTSW 1 46340132 missense probably benign 0.00
R0931:Dnah7b UTSW 1 46099612 splice site probably benign
R1035:Dnah7b UTSW 1 46124448 missense probably benign
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1147:Dnah7b UTSW 1 46340266 missense probably damaging 0.99
R1166:Dnah7b UTSW 1 46325810 missense probably damaging 1.00
R1219:Dnah7b UTSW 1 46340120 missense probably benign 0.00
R1318:Dnah7b UTSW 1 46099509 missense possibly damaging 0.80
R1334:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1429:Dnah7b UTSW 1 46289656 missense possibly damaging 0.84
R1440:Dnah7b UTSW 1 46078593 splice site probably benign
R1484:Dnah7b UTSW 1 46137543 missense probably benign 0.00
R1529:Dnah7b UTSW 1 46177281 missense probably damaging 1.00
R1544:Dnah7b UTSW 1 46066797 missense unknown
R1607:Dnah7b UTSW 1 46290646 missense probably damaging 1.00
R1609:Dnah7b UTSW 1 46352966 missense probably damaging 1.00
R1652:Dnah7b UTSW 1 46175390 nonsense probably null
R1681:Dnah7b UTSW 1 46324712 nonsense probably null
R1716:Dnah7b UTSW 1 46191783 missense probably damaging 1.00
R1753:Dnah7b UTSW 1 46322335 missense probably damaging 0.99
R1834:Dnah7b UTSW 1 46233759 missense possibly damaging 0.90
R1838:Dnah7b UTSW 1 46116177 missense probably benign 0.04
R1838:Dnah7b UTSW 1 46277105 missense probably damaging 1.00
R1898:Dnah7b UTSW 1 46236714 missense probably benign 0.02
R1962:Dnah7b UTSW 1 46242103 missense possibly damaging 0.95
R2001:Dnah7b UTSW 1 46142087 missense possibly damaging 0.69
R2049:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2076:Dnah7b UTSW 1 46242321 nonsense probably null
R2083:Dnah7b UTSW 1 46241067 missense possibly damaging 0.90
R2140:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2141:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2142:Dnah7b UTSW 1 46268670 missense probably damaging 1.00
R2165:Dnah7b UTSW 1 46097992 splice site probably benign
R2172:Dnah7b UTSW 1 46124512 missense probably benign 0.12
R2239:Dnah7b UTSW 1 46201184 splice site probably benign
R2247:Dnah7b UTSW 1 46277063 missense probably damaging 1.00
R2267:Dnah7b UTSW 1 46233915 missense probably damaging 1.00
R2405:Dnah7b UTSW 1 46362954 missense probably benign 0.31
R2509:Dnah7b UTSW 1 46195287 missense probably damaging 0.96
R2895:Dnah7b UTSW 1 46139741 missense probably damaging 1.00
R2965:Dnah7b UTSW 1 46207572 missense probably damaging 1.00
R3013:Dnah7b UTSW 1 46188687 critical splice donor site probably null
R3022:Dnah7b UTSW 1 46182423 missense probably damaging 0.99
R3056:Dnah7b UTSW 1 46268709 missense possibly damaging 0.95
R3107:Dnah7b UTSW 1 46352873 missense probably benign 0.00
R3735:Dnah7b UTSW 1 46299875 missense probably benign 0.05
R3898:Dnah7b UTSW 1 46243257 missense probably damaging 1.00
R3944:Dnah7b UTSW 1 46137485 missense probably damaging 1.00
R3983:Dnah7b UTSW 1 46233711 missense possibly damaging 0.88
R4041:Dnah7b UTSW 1 46081495 missense probably benign
R4172:Dnah7b UTSW 1 46226946 missense probably damaging 1.00
R4210:Dnah7b UTSW 1 46137418 missense possibly damaging 0.63
R4306:Dnah7b UTSW 1 46221772 missense probably damaging 0.99
R4391:Dnah7b UTSW 1 46337594 splice site probably null
R4414:Dnah7b UTSW 1 46126680 missense probably benign 0.00
R4495:Dnah7b UTSW 1 46085632 missense probably benign 0.00
R4660:Dnah7b UTSW 1 46289536 missense probably damaging 1.00
R4670:Dnah7b UTSW 1 46078524 missense probably damaging 1.00
R4675:Dnah7b UTSW 1 46217157 missense possibly damaging 0.89
R4685:Dnah7b UTSW 1 46211328 missense probably damaging 1.00
R4727:Dnah7b UTSW 1 46207656 missense probably damaging 1.00
R4735:Dnah7b UTSW 1 46066955 missense unknown
R4780:Dnah7b UTSW 1 46353014 missense probably benign
R4828:Dnah7b UTSW 1 46128112 missense possibly damaging 0.59
R4859:Dnah7b UTSW 1 46356602 missense probably damaging 1.00
R4865:Dnah7b UTSW 1 46195074 missense probably damaging 1.00
R4871:Dnah7b UTSW 1 46081444 missense probably benign 0.21
R4881:Dnah7b UTSW 1 46201318 missense probably damaging 1.00
R4902:Dnah7b UTSW 1 46290775 missense probably benign 0.04
R4960:Dnah7b UTSW 1 46233726 missense probably benign
R5000:Dnah7b UTSW 1 46099503 nonsense probably null
R5005:Dnah7b UTSW 1 46242028 missense probably damaging 0.99
R5026:Dnah7b UTSW 1 46187363 missense probably damaging 0.99
R5080:Dnah7b UTSW 1 46182380 nonsense probably null
R5174:Dnah7b UTSW 1 46243349 missense possibly damaging 0.83
R5178:Dnah7b UTSW 1 46358216 missense possibly damaging 0.50
R5244:Dnah7b UTSW 1 46233858 missense probably damaging 1.00
R5250:Dnah7b UTSW 1 46373354 missense probably damaging 1.00
R5350:Dnah7b UTSW 1 46233689 missense probably benign 0.16
R5380:Dnah7b UTSW 1 46217191 missense probably benign 0.18
R5387:Dnah7b UTSW 1 46188659 missense probably damaging 1.00
R5423:Dnah7b UTSW 1 46358271 missense probably benign 0.01
R5426:Dnah7b UTSW 1 46242206 missense possibly damaging 0.82
R5451:Dnah7b UTSW 1 46242019 missense possibly damaging 0.73
R5459:Dnah7b UTSW 1 46109312 missense probably null
R5479:Dnah7b UTSW 1 46223105 missense probably damaging 1.00
R5583:Dnah7b UTSW 1 46242199 missense probably benign 0.06
R5637:Dnah7b UTSW 1 46356514 missense possibly damaging 0.95
R5641:Dnah7b UTSW 1 46268764 splice site probably null
R5659:Dnah7b UTSW 1 46352849 missense probably damaging 1.00
R5739:Dnah7b UTSW 1 46233992 missense probably damaging 1.00
R5759:Dnah7b UTSW 1 46277120 missense probably damaging 1.00
R5821:Dnah7b UTSW 1 46142132 missense possibly damaging 0.91
R5874:Dnah7b UTSW 1 46191725 missense probably damaging 1.00
R5892:Dnah7b UTSW 1 46337593 critical splice donor site probably null
R5918:Dnah7b UTSW 1 46221643 missense probably benign
R5941:Dnah7b UTSW 1 46187290 missense probably damaging 1.00
R5965:Dnah7b UTSW 1 46362987 missense probably damaging 1.00
R5987:Dnah7b UTSW 1 46119398 intron probably null
R6041:Dnah7b UTSW 1 46289645 missense probably benign 0.04
R6043:Dnah7b UTSW 1 46139789 missense probably benign
R6049:Dnah7b UTSW 1 46085602 missense probably benign
R6131:Dnah7b UTSW 1 46253466 missense probably damaging 1.00
R6168:Dnah7b UTSW 1 46290703 missense probably damaging 1.00
R6195:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6219:Dnah7b UTSW 1 46233585 missense probably benign 0.03
R6226:Dnah7b UTSW 1 46126668 missense probably benign 0.01
R6233:Dnah7b UTSW 1 46204269 missense probably damaging 1.00
R6247:Dnah7b UTSW 1 46225888 missense probably benign
R6273:Dnah7b UTSW 1 46242316 missense possibly damaging 0.94
R6279:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6300:Dnah7b UTSW 1 46325886 missense probably damaging 1.00
R6330:Dnah7b UTSW 1 46340175 missense probably damaging 1.00
R6476:Dnah7b UTSW 1 46242204 nonsense probably null
R6494:Dnah7b UTSW 1 46099431 missense probably damaging 1.00
R6762:Dnah7b UTSW 1 46224742 missense probably benign 0.12
R6800:Dnah7b UTSW 1 46340217 missense possibly damaging 0.90
R6838:Dnah7b UTSW 1 46191788 missense probably damaging 1.00
R6937:Dnah7b UTSW 1 46195120 missense probably damaging 1.00
R6940:Dnah7b UTSW 1 46119268 missense probably benign 0.12
R6969:Dnah7b UTSW 1 46358238 missense probably damaging 1.00
R6993:Dnah7b UTSW 1 46195139 critical splice donor site probably null
R7040:Dnah7b UTSW 1 46236809 missense probably benign 0.01
R7117:Dnah7b UTSW 1 46352813 critical splice acceptor site probably null
R7135:Dnah7b UTSW 1 46139710 missense probably damaging 0.99
R7153:Dnah7b UTSW 1 46126804 missense probably benign 0.05
R7189:Dnah7b UTSW 1 46242142 missense probably damaging 1.00
R7237:Dnah7b UTSW 1 46139966 missense probably damaging 0.98
R7243:Dnah7b UTSW 1 46083754 missense probably benign
R7244:Dnah7b UTSW 1 46277143 missense probably damaging 0.99
R7248:Dnah7b UTSW 1 46142085 missense possibly damaging 0.83
R7318:Dnah7b UTSW 1 46195372 missense probably damaging 1.00
R7375:Dnah7b UTSW 1 46303634 missense probably damaging 1.00
R7483:Dnah7b UTSW 1 46175419 missense probably damaging 1.00
R7498:Dnah7b UTSW 1 46325765 missense probably damaging 1.00
R7501:Dnah7b UTSW 1 46356554 missense probably damaging 1.00
R7513:Dnah7b UTSW 1 46124346 missense probably benign 0.06
R7547:Dnah7b UTSW 1 46214413 missense possibly damaging 0.82
R7620:Dnah7b UTSW 1 46268634 missense probably damaging 1.00
R7670:Dnah7b UTSW 1 46109302 missense probably benign
R7676:Dnah7b UTSW 1 46234164 nonsense probably null
R7731:Dnah7b UTSW 1 46139745 missense probably benign 0.00
V8831:Dnah7b UTSW 1 46373298 nonsense probably null
X0023:Dnah7b UTSW 1 46303577 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAAAGCTGTACTTCATTCTAGGCAG -3'
(R):5'- ACGGTCATTTTCCCTAGTGTAAG -3'

Sequencing Primer
(F):5'- GTACTTCATTCTAGGCAGTTAAAGG -3'
(R):5'- TCCCTAGTGTAAGATTAGCGTTC -3'
Posted On2019-10-07