Incidental Mutation 'R7486:Blvra'
ID580139
Institutional Source Beutler Lab
Gene Symbol Blvra
Ensembl Gene ENSMUSG00000001999
Gene Namebiliverdin reductase A
Synonyms0610006A11Rik, Blvr, 2500001N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7486 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location127070665-127097084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127087323 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000106019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000110389] [ENSMUST00000135529] [ENSMUST00000142737]
Predicted Effect probably benign
Transcript: ENSMUST00000002064
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110389
AA Change: S136P
SMART Domains Protein: ENSMUSP00000106019
Gene: ENSMUSG00000001999
AA Change: S136P

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135529
SMART Domains Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 1e-22 PFAM
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142737
SMART Domains Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 4.7e-24 PFAM
Pfam:NAD_binding_3 15 122 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Blvra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Blvra APN 2 127082951 missense probably damaging 1.00
R1084:Blvra UTSW 2 127080653 missense probably benign 0.00
R1932:Blvra UTSW 2 127095148 missense probably damaging 1.00
R2114:Blvra UTSW 2 127086069 nonsense probably null
R2115:Blvra UTSW 2 127086069 nonsense probably null
R2117:Blvra UTSW 2 127086069 nonsense probably null
R2122:Blvra UTSW 2 127086897 missense probably damaging 0.96
R3734:Blvra UTSW 2 127090255 intron probably benign
R3847:Blvra UTSW 2 127095191 missense probably damaging 0.96
R4110:Blvra UTSW 2 127095155 missense probably damaging 1.00
R4533:Blvra UTSW 2 127090384 splice site probably null
R4620:Blvra UTSW 2 127096965 missense probably damaging 1.00
R4702:Blvra UTSW 2 127092062 missense probably benign 0.01
R5921:Blvra UTSW 2 127087363 intron probably benign
R6322:Blvra UTSW 2 127080539 start gained probably benign
R7474:Blvra UTSW 2 127086849 missense probably damaging 1.00
R8188:Blvra UTSW 2 127095127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGGTTGCCACATGTCACAG -3'
(R):5'- GACAACCACTTACATTGATTTGGG -3'

Sequencing Primer
(F):5'- ACAGTGGCATGATGTTGATATTGTAC -3'
(R):5'- GGTGCTGTTTACTGGAAAAACCC -3'
Posted On2019-10-07