Incidental Mutation 'R7486:Chd6'
ID580142
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R7486 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160950003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 2478 (V2478A)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: V2478A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: V2478A

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4779:Chd6 UTSW 2 160949557 missense probably damaging 1.00
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
R7061:Chd6 UTSW 2 161025965 nonsense probably null
R7064:Chd6 UTSW 2 160950063 missense probably damaging 1.00
R7248:Chd6 UTSW 2 160961279 nonsense probably null
R7287:Chd6 UTSW 2 161008392 missense probably benign 0.07
R7431:Chd6 UTSW 2 161026328 missense possibly damaging 0.92
R7509:Chd6 UTSW 2 161013154 missense probably damaging 1.00
R7699:Chd6 UTSW 2 161025943 missense probably benign 0.13
R7748:Chd6 UTSW 2 160966619 missense probably benign 0.37
R7785:Chd6 UTSW 2 160970175 missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8261:Chd6 UTSW 2 160957082 missense probably damaging 1.00
R8317:Chd6 UTSW 2 160990321 missense probably damaging 1.00
R8388:Chd6 UTSW 2 161019651 missense probably damaging 1.00
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACTCCAAACATCTGGG -3'
(R):5'- TTTGCCATCTGGTGACTTTCAG -3'

Sequencing Primer
(F):5'- CAGGGTGTTCTTAACCTCT -3'
(R):5'- GGTGACTTTCAGCATCCAATG -3'
Posted On2019-10-07