Incidental Mutation 'R0631:Scn8a'
ID58015
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 038820-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R0631 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101035537 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1500 (T1500A)
Ref Sequence ENSEMBL: ENSMUSP00000144371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201549]
Predicted Effect probably damaging
Transcript: ENSMUST00000082209
AA Change: T1541A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: T1541A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108908
AA Change: T1541A

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: T1541A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: T1551A

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: T1551A

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108910
AA Change: T1541A

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: T1541A

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200963
AA Change: T1500A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: T1500A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201549
AA Change: T1541A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: T1541A

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T A 9: 51,101,953 R6S probably benign Het
Aadat T C 8: 60,529,445 probably benign Het
Afap1l2 T C 19: 56,916,085 E594G probably benign Het
Ak8 T G 2: 28,735,665 I240S probably damaging Het
Akap13 T C 7: 75,614,996 V174A probably damaging Het
Alppl2 G A 1: 87,089,373 T66I probably damaging Het
Ankrd61 T A 5: 143,894,879 I36F probably damaging Het
Antxrl T A 14: 34,058,801 probably null Het
Arhgef2 G C 3: 88,634,436 V244L probably damaging Het
Arid1a A G 4: 133,689,170 I1098T unknown Het
Atr T C 9: 95,874,777 V903A possibly damaging Het
AW549877 A G 15: 3,986,489 probably benign Het
B3gnt6 C A 7: 98,193,692 A354S probably benign Het
Bnc1 A T 7: 81,974,366 I371N probably damaging Het
Camsap1 A T 2: 25,933,647 S1464T probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Cass4 T C 2: 172,432,411 I728T probably damaging Het
Ccdc88a A T 11: 29,493,752 M1378L probably damaging Het
Ccdc9 C A 7: 16,278,459 W266L probably damaging Het
Cct6b C A 11: 82,737,088 probably null Het
Cd177 T C 7: 24,756,686 E219G probably benign Het
Cdkal1 A T 13: 29,354,684 Y497* probably null Het
Chmp2a T C 7: 13,032,444 E107G probably damaging Het
Chrna2 T G 14: 66,149,308 V301G probably benign Het
Chrna7 A G 7: 63,099,643 C364R probably benign Het
Cltc G T 11: 86,712,613 L796I probably benign Het
Col12a1 T C 9: 79,703,376 T249A probably damaging Het
Col13a1 G A 10: 61,887,350 Q270* probably null Het
Col6a1 C T 10: 76,709,735 V968M probably benign Het
Copb1 C A 7: 114,233,282 V511F probably benign Het
Daw1 C G 1: 83,197,260 S160R probably damaging Het
Ddx46 A G 13: 55,639,777 probably benign Het
Depdc7 T C 2: 104,721,987 K492E possibly damaging Het
Dmbt1 C T 7: 131,097,653 A1004V possibly damaging Het
Dnah7b G A 1: 46,240,992 V2694I probably benign Het
Dnhd1 T A 7: 105,651,624 F63I probably benign Het
Edc4 C A 8: 105,890,792 A1052E possibly damaging Het
Eif2s2 T A 2: 154,884,358 K129M probably damaging Het
Emx2 A G 19: 59,464,028 D248G probably damaging Het
Erich6b T C 14: 75,659,009 probably benign Het
Exoc3l4 A G 12: 111,427,966 K507E probably benign Het
Fanci T A 7: 79,406,205 V195E probably damaging Het
Fgfr2 T G 7: 130,227,239 probably benign Het
Frem1 A G 4: 82,972,165 S1007P probably damaging Het
Fry T C 5: 150,496,352 I993T possibly damaging Het
Fst A G 13: 114,454,502 S244P possibly damaging Het
Gcc1 T C 6: 28,421,010 T103A probably damaging Het
Gdf2 C T 14: 33,941,221 P24L probably damaging Het
Gja3 T C 14: 57,036,762 D51G possibly damaging Het
Gm10305 A G 4: 99,273,076 D74G unknown Het
Gm12689 G T 4: 99,296,021 G37V unknown Het
Gm5424 C T 10: 62,071,534 noncoding transcript Het
Hephl1 T C 9: 15,084,524 E434G probably benign Het
Htatip2 T C 7: 49,773,311 C205R possibly damaging Het
Igf2r T C 17: 12,717,274 probably null Het
Ints2 T C 11: 86,233,196 I589V probably benign Het
Itgae T A 11: 73,114,907 V299D probably damaging Het
Kcnma1 T C 14: 23,509,784 probably benign Het
Kif11 A G 19: 37,413,117 probably benign Het
Kif13a A G 13: 46,778,888 probably benign Het
Kif18a T A 2: 109,298,322 probably benign Het
Klhl29 T C 12: 5,094,883 T406A probably benign Het
Litaf A T 16: 10,966,412 probably benign Het
Lmntd1 T A 6: 145,430,000 I71F probably benign Het
Lrit3 A C 3: 129,788,555 C594W probably damaging Het
Lrp6 T A 6: 134,479,775 Q842L possibly damaging Het
Lrrcc1 T A 3: 14,540,119 probably benign Het
Macf1 A T 4: 123,455,524 L1829* probably null Het
Mapk1ip1 T C 7: 138,835,955 T249A possibly damaging Het
Mfap4 T C 11: 61,487,180 F173L probably damaging Het
Mfsd9 C A 1: 40,790,474 probably benign Het
Mgat4b T C 11: 50,230,763 S69P probably damaging Het
Mki67 A T 7: 135,704,388 V620D probably damaging Het
Moxd1 C T 10: 24,252,954 T201I probably damaging Het
Msh4 G C 3: 153,866,420 D774E probably benign Het
Myg1 C T 15: 102,331,849 R37C probably benign Het
Myrf C A 19: 10,228,882 A57S probably benign Het
Ndst1 G A 18: 60,700,359 probably benign Het
Nedd4l A T 18: 65,208,503 probably benign Het
Neil2 T A 14: 63,183,400 I281F possibly damaging Het
Nfatc2 T A 2: 168,590,115 D26V probably benign Het
Nt5c A G 11: 115,490,714 probably null Het
Olfr1095 T C 2: 86,850,967 T244A probably benign Het
Olfr1369-ps1 G T 13: 21,115,908 C72F probably damaging Het
Olfr202 A G 16: 59,284,207 C97R possibly damaging Het
Olfr372 T A 8: 72,058,322 I214N probably damaging Het
Olfr538 T G 7: 140,574,507 M118R probably damaging Het
Ovch2 A G 7: 107,782,021 S557P probably benign Het
Pik3cg A G 12: 32,205,203 S262P probably benign Het
Pla2g6 T A 15: 79,306,396 H322L probably damaging Het
Plch1 A T 3: 63,699,219 L1079Q probably benign Het
Plekhg4 T A 8: 105,379,302 V777D probably damaging Het
Plekhg5 A G 4: 152,112,419 D747G possibly damaging Het
Poln C A 5: 34,118,958 V318F possibly damaging Het
Pou5f2 T A 13: 78,025,754 S272T probably benign Het
Ppp1r3e T G 14: 54,876,616 S200R possibly damaging Het
Prl7d1 G A 13: 27,710,182 P135S probably benign Het
Ptgs2 G A 1: 150,104,537 V409I probably benign Het
Ptk2b T C 14: 66,177,751 T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 T747A probably damaging Het
Qrfpr A G 3: 36,221,989 I84T probably damaging Het
Rab44 A G 17: 29,139,144 D102G possibly damaging Het
Rnf125 A T 18: 20,979,083 D57V possibly damaging Het
Rnf145 T C 11: 44,560,024 F392L probably damaging Het
Rttn A G 18: 88,989,546 N435S probably benign Het
Sgsm1 A G 5: 113,285,123 probably benign Het
Sgsm3 A T 15: 81,011,736 *751C probably null Het
Slc35c2 A C 2: 165,280,929 L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 E396V probably damaging Het
Smarca4 G C 9: 21,658,984 probably benign Het
Snapc3 T A 4: 83,417,802 V17D probably damaging Het
Snta1 G T 2: 154,377,072 Q448K probably benign Het
Sptbn2 A G 19: 4,739,986 D1334G probably benign Het
Stard5 A G 7: 83,632,757 R41G probably damaging Het
Stxbp5 T A 10: 9,784,358 N731I probably benign Het
Tmem135 T A 7: 89,143,788 K413* probably null Het
Tmem38a G A 8: 72,580,018 V114I probably benign Het
Tpr A G 1: 150,422,531 T1057A probably damaging Het
Ttc23l A T 15: 10,539,980 L139Q probably damaging Het
Ttn T A 2: 76,755,296 probably null Het
Tuba3b A G 6: 145,619,576 T257A probably damaging Het
Tubgcp6 A C 15: 89,100,987 Y1633D probably damaging Het
Txnl1 C T 18: 63,671,573 probably benign Het
Unc13b A G 4: 43,182,849 Q3186R possibly damaging Het
Vmn2r75 T A 7: 86,163,270 S514C probably null Het
Whrn G A 4: 63,419,489 T545I probably damaging Het
Zdhhc20 T C 14: 57,857,640 H154R probably damaging Het
Zfp462 A T 4: 55,007,563 M1L possibly damaging Het
Zfp831 A G 2: 174,645,290 K586R possibly damaging Het
Zfp990 A T 4: 145,537,302 H290L possibly damaging Het
Zfpm1 C T 8: 122,336,874 probably benign Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAGGACACTGGACCAGCTATC -3'
(R):5'- CAGCATTTGCACCAAGAGTGCC -3'

Sequencing Primer
(F):5'- CTATCCCAAAGTGGGCTCTG -3'
(R):5'- AGAGCTAGTCACTGCTCTCAG -3'
Posted On2013-07-11