Incidental Mutation 'R7486:Pgghg'
ID580168
Institutional Source Beutler Lab
Gene Symbol Pgghg
Ensembl Gene ENSMUSG00000062031
Gene Nameprotein glucosylgalactosylhydroxylysine glucosidase
Synonyms5730511L01Rik, Athl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R7486 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140941391-140947664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140942480 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 57 (S57R)
Ref Sequence ENSEMBL: ENSMUSP00000078372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580]
Predicted Effect probably benign
Transcript: ENSMUST00000079403
AA Change: S57R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031
AA Change: S57R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect
Predicted Effect
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031
AA Change: S57R

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Pgghg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Pgghg APN 7 140945351 critical splice donor site probably null
IGL00848:Pgghg APN 7 140942404 missense probably damaging 1.00
IGL01903:Pgghg APN 7 140946828 missense probably benign 0.03
IGL02060:Pgghg APN 7 140946633 missense probably benign 0.30
IGL02475:Pgghg APN 7 140945720 missense
IGL02519:Pgghg APN 7 140944981 missense possibly damaging 0.94
IGL02612:Pgghg APN 7 140946338 missense probably damaging 1.00
R0689:Pgghg UTSW 7 140943278 missense probably benign 0.08
R1696:Pgghg UTSW 7 140945311 missense possibly damaging 0.55
R1960:Pgghg UTSW 7 140943347 missense probably benign
R2110:Pgghg UTSW 7 140943540 missense possibly damaging 0.72
R3809:Pgghg UTSW 7 140945295 missense probably damaging 1.00
R3890:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R3891:Pgghg UTSW 7 140945703 missense probably damaging 0.99
R4622:Pgghg UTSW 7 140941496 splice site probably null
R5009:Pgghg UTSW 7 140943390 missense probably benign
R5058:Pgghg UTSW 7 140942542 missense possibly damaging 0.46
R5215:Pgghg UTSW 7 140946564 missense possibly damaging 0.64
R6122:Pgghg UTSW 7 140943395 missense possibly damaging 0.87
R6269:Pgghg UTSW 7 140946184 missense probably damaging 0.97
R6301:Pgghg UTSW 7 140946376 missense probably damaging 1.00
R6562:Pgghg UTSW 7 140946593 missense probably benign 0.01
R7054:Pgghg UTSW 7 140944718 missense probably benign 0.15
R7241:Pgghg UTSW 7 140945720 missense
R7320:Pgghg UTSW 7 140943040 missense probably benign 0.44
R7665:Pgghg UTSW 7 140945469 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGACGGCTCTGAAGATGAC -3'
(R):5'- CACAGGCCTCATTTTGGGAG -3'

Sequencing Primer
(F):5'- TGAAGATGACCCGACCATATTCAGTG -3'
(R):5'- TACCAGTGCCAAGGTTACAGGC -3'
Posted On2019-10-07