Incidental Mutation 'R7486:Pcnt'
ID 580181
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Name pericentrin (kendrin)
Synonyms m275Asp, m239Asp, Pcnt2
MMRRC Submission 045560-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7486 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 76187097-76278620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76254270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 853 (T853K)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000001179
AA Change: T853K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: T853K

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000217838
AA Change: T853K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,605,657 (GRCm39) I702V probably benign Het
Adgre5 T C 8: 84,450,515 (GRCm39) E815G probably damaging Het
Adgrl2 A G 3: 148,523,330 (GRCm39) V298A Het
Akp3 A G 1: 87,053,201 (GRCm39) D91G probably damaging Het
Ano8 A G 8: 71,937,642 (GRCm39) probably null Het
Blvra T C 2: 126,929,243 (GRCm39) S136P unknown Het
Cacul1 T A 19: 60,568,868 (GRCm39) M97L probably benign Het
Ccdc80 T C 16: 44,946,542 (GRCm39) V827A probably damaging Het
Cep68 T C 11: 20,192,166 (GRCm39) E11G probably benign Het
Cfap221 A T 1: 119,851,322 (GRCm39) V813E possibly damaging Het
Chd6 A G 2: 160,791,923 (GRCm39) V2478A probably damaging Het
Chmp6 T C 11: 119,807,783 (GRCm39) F148S probably benign Het
Clca3a2 T A 3: 144,503,362 (GRCm39) I863F probably damaging Het
Cnnm2 T C 19: 46,750,513 (GRCm39) V101A possibly damaging Het
Cpne8 A T 15: 90,400,109 (GRCm39) probably null Het
Dmbt1 T G 7: 130,668,192 (GRCm39) C483G unknown Het
Dnah7b G A 1: 46,329,894 (GRCm39) G3246D probably damaging Het
Dnajc3 C A 14: 119,209,816 (GRCm39) T297K probably benign Het
Dpm3 A G 3: 89,174,034 (GRCm39) probably null Het
Eef2k A G 7: 120,457,793 (GRCm39) N51D probably benign Het
Erc1 G A 6: 119,571,907 (GRCm39) Q1022* probably null Het
Ercc5 T A 1: 44,187,224 (GRCm39) M1K probably null Het
Fam114a2 C T 11: 57,404,515 (GRCm39) G83D probably damaging Het
Fat4 C A 3: 39,011,576 (GRCm39) Y2225* probably null Het
Frk G A 10: 34,423,292 (GRCm39) W123* probably null Het
Gm11568 T A 11: 99,749,292 (GRCm39) C166S unknown Het
Gpr153 A G 4: 152,366,858 (GRCm39) D337G probably benign Het
Gpt2 T C 8: 86,252,235 (GRCm39) F517L probably damaging Het
Gsg1 C T 6: 135,214,427 (GRCm39) E361K probably benign Het
Hsfy2 G A 1: 56,676,130 (GRCm39) R136* probably null Het
Insm1 G A 2: 146,065,738 (GRCm39) R518H probably damaging Het
Kank1 G A 19: 25,388,193 (GRCm39) C622Y probably damaging Het
Katnb1 T A 8: 95,825,357 (GRCm39) S640R probably damaging Het
Kcnmb4 A G 10: 116,254,180 (GRCm39) V199A probably benign Het
Lamb1 T G 12: 31,337,441 (GRCm39) S391A probably benign Het
Larp7-ps A T 4: 92,079,506 (GRCm39) V105E probably benign Het
Macf1 T G 4: 123,303,374 (GRCm39) D376A probably benign Het
Map7d1 C A 4: 126,128,179 (GRCm39) R614L unknown Het
Mcm8 C T 2: 132,681,440 (GRCm39) R667W probably damaging Het
Med13l C T 5: 118,866,539 (GRCm39) T531I probably benign Het
Mstn G T 1: 53,103,128 (GRCm39) A155S probably damaging Het
Mycbp2 C T 14: 103,434,690 (GRCm39) R2251K probably damaging Het
Myo19 T C 11: 84,796,463 (GRCm39) S692P probably benign Het
Nipbl A T 15: 8,325,120 (GRCm39) N2514K probably benign Het
Nkd2 T A 13: 73,995,561 (GRCm39) probably benign Het
Nox3 T A 17: 3,720,219 (GRCm39) Y322F probably damaging Het
Nt5dc1 A G 10: 34,275,805 (GRCm39) Y135H probably benign Het
Oog3 T A 4: 143,884,742 (GRCm39) H398L probably benign Het
Or10g9 T A 9: 39,912,181 (GRCm39) Y114F probably benign Het
Or12j4 C T 7: 140,045,947 (GRCm39) probably benign Het
Or1e29 T C 11: 73,667,847 (GRCm39) Y102C probably damaging Het
Otogl A G 10: 107,657,849 (GRCm39) L1027P probably damaging Het
Pcdh20 T A 14: 88,706,050 (GRCm39) I417F possibly damaging Het
Pcdha12 T A 18: 37,154,610 (GRCm39) V443E probably damaging Het
Pcdhga2 A G 18: 37,803,461 (GRCm39) D435G probably benign Het
Pgghg T A 7: 140,522,393 (GRCm39) S57R probably benign Het
Ppm1m T C 9: 106,073,810 (GRCm39) D301G probably damaging Het
Ppp6r1 A G 7: 4,642,899 (GRCm39) V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 24,063,072 (GRCm39) probably benign Het
Rasa3 C T 8: 13,640,201 (GRCm39) probably null Het
Robo4 T C 9: 37,316,870 (GRCm39) V395A probably damaging Het
Scrib A G 15: 75,929,499 (GRCm39) S1123P probably damaging Het
Setd1b A G 5: 123,301,655 (GRCm39) K45E probably benign Het
Slc14a1 T C 18: 78,154,739 (GRCm39) S216G probably benign Het
Slc25a45 A G 19: 5,934,997 (GRCm39) Y282C probably damaging Het
Slc6a5 T C 7: 49,567,078 (GRCm39) S255P possibly damaging Het
Smc2 A T 4: 52,462,861 (GRCm39) Q617L possibly damaging Het
Spo11 G A 2: 172,825,870 (GRCm39) D103N probably benign Het
Tcf20 A T 15: 82,737,935 (GRCm39) M1172K possibly damaging Het
Tesc T A 5: 118,184,382 (GRCm39) S21T probably benign Het
Tie1 C A 4: 118,337,101 (GRCm39) probably null Het
Trim24 T G 6: 37,934,774 (GRCm39) probably null Het
Trpm7 A G 2: 126,673,115 (GRCm39) probably null Het
Unc13d T C 11: 115,965,259 (GRCm39) D193G possibly damaging Het
Upk3a A T 15: 84,902,225 (GRCm39) probably null Het
Vmn2r25 T C 6: 123,800,101 (GRCm39) N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,270,418 (GRCm39) probably benign Het
Zbtb2 G A 10: 4,319,025 (GRCm39) Q334* probably null Het
Zfp653 T C 9: 21,967,824 (GRCm39) N494D probably damaging Het
Zfp865 A G 7: 5,034,259 (GRCm39) D748G possibly damaging Het
Zzef1 T C 11: 72,755,612 (GRCm39) S1014P possibly damaging Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76,258,738 (GRCm39) nonsense probably null
IGL01307:Pcnt APN 10 76,247,422 (GRCm39) missense probably damaging 1.00
IGL01549:Pcnt APN 10 76,203,320 (GRCm39) splice site probably null
IGL01576:Pcnt APN 10 76,204,656 (GRCm39) missense probably damaging 0.99
IGL01611:Pcnt APN 10 76,272,258 (GRCm39) critical splice donor site probably null
IGL01630:Pcnt APN 10 76,256,080 (GRCm39) missense probably damaging 0.99
IGL01647:Pcnt APN 10 76,205,835 (GRCm39) nonsense probably null
IGL01689:Pcnt APN 10 76,247,487 (GRCm39) missense probably damaging 1.00
IGL01690:Pcnt APN 10 76,228,609 (GRCm39) missense probably damaging 1.00
IGL01723:Pcnt APN 10 76,254,333 (GRCm39) missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76,240,362 (GRCm39) missense probably damaging 1.00
IGL01958:Pcnt APN 10 76,269,513 (GRCm39) missense probably damaging 0.96
IGL02210:Pcnt APN 10 76,225,053 (GRCm39) missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02228:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02237:Pcnt APN 10 76,188,818 (GRCm39) missense probably damaging 1.00
IGL02279:Pcnt APN 10 76,239,599 (GRCm39) missense probably damaging 1.00
IGL02303:Pcnt APN 10 76,278,393 (GRCm39) splice site probably benign
IGL02355:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02362:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02428:Pcnt APN 10 76,265,090 (GRCm39) missense probably damaging 0.99
IGL02536:Pcnt APN 10 76,216,063 (GRCm39) missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76,204,556 (GRCm39) splice site probably benign
IGL02800:Pcnt APN 10 76,248,417 (GRCm39) nonsense probably null
IGL03395:Pcnt APN 10 76,272,325 (GRCm39) missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76,248,417 (GRCm39) nonsense probably null
PIT4520001:Pcnt UTSW 10 76,256,069 (GRCm39) missense probably damaging 0.99
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0109:Pcnt UTSW 10 76,225,030 (GRCm39) missense probably benign 0.00
R0117:Pcnt UTSW 10 76,244,561 (GRCm39) nonsense probably null
R0254:Pcnt UTSW 10 76,228,414 (GRCm39) missense probably benign 0.10
R0392:Pcnt UTSW 10 76,220,660 (GRCm39) missense probably benign
R0511:Pcnt UTSW 10 76,240,429 (GRCm39) missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76,247,941 (GRCm39) missense probably damaging 1.00
R0614:Pcnt UTSW 10 76,256,150 (GRCm39) missense probably damaging 1.00
R0635:Pcnt UTSW 10 76,240,419 (GRCm39) missense probably damaging 1.00
R0707:Pcnt UTSW 10 76,256,375 (GRCm39) missense probably damaging 1.00
R0749:Pcnt UTSW 10 76,217,198 (GRCm39) missense probably damaging 1.00
R0969:Pcnt UTSW 10 76,263,785 (GRCm39) missense probably damaging 1.00
R1172:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1174:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1175:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1512:Pcnt UTSW 10 76,240,496 (GRCm39) splice site probably null
R1542:Pcnt UTSW 10 76,237,220 (GRCm39) missense probably benign 0.02
R1542:Pcnt UTSW 10 76,225,221 (GRCm39) missense probably benign 0.08
R1558:Pcnt UTSW 10 76,258,756 (GRCm39) missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76,203,164 (GRCm39) missense probably benign 0.02
R1762:Pcnt UTSW 10 76,190,971 (GRCm39) critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76,244,630 (GRCm39) missense probably damaging 0.99
R1869:Pcnt UTSW 10 76,215,740 (GRCm39) missense probably null 0.94
R1911:Pcnt UTSW 10 76,204,650 (GRCm39) missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76,216,171 (GRCm39) missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76,228,633 (GRCm39) nonsense probably null
R2073:Pcnt UTSW 10 76,216,214 (GRCm39) missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2112:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2309:Pcnt UTSW 10 76,278,460 (GRCm39) start gained probably benign
R2902:Pcnt UTSW 10 76,211,064 (GRCm39) missense probably damaging 0.98
R3623:Pcnt UTSW 10 76,269,584 (GRCm39) missense probably benign 0.23
R4088:Pcnt UTSW 10 76,263,848 (GRCm39) missense probably damaging 1.00
R4300:Pcnt UTSW 10 76,203,225 (GRCm39) missense probably benign 0.40
R4402:Pcnt UTSW 10 76,228,227 (GRCm39) missense probably benign 0.00
R4407:Pcnt UTSW 10 76,210,704 (GRCm39) missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76,237,317 (GRCm39) missense probably damaging 1.00
R4647:Pcnt UTSW 10 76,190,047 (GRCm39) missense probably benign 0.01
R4734:Pcnt UTSW 10 76,273,040 (GRCm39) missense probably benign 0.25
R4747:Pcnt UTSW 10 76,272,299 (GRCm39) missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76,245,411 (GRCm39) missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76,205,858 (GRCm39) missense probably benign 0.21
R4831:Pcnt UTSW 10 76,248,335 (GRCm39) missense probably damaging 0.96
R4873:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4875:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4946:Pcnt UTSW 10 76,192,019 (GRCm39) missense probably damaging 1.00
R5032:Pcnt UTSW 10 76,190,911 (GRCm39) missense probably benign 0.00
R5033:Pcnt UTSW 10 76,235,779 (GRCm39) missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76,237,278 (GRCm39) missense probably damaging 1.00
R5118:Pcnt UTSW 10 76,248,002 (GRCm39) missense probably damaging 0.98
R5167:Pcnt UTSW 10 76,256,258 (GRCm39) missense probably damaging 0.97
R5199:Pcnt UTSW 10 76,254,378 (GRCm39) missense probably benign 0.09
R5223:Pcnt UTSW 10 76,216,106 (GRCm39) missense probably damaging 0.99
R5241:Pcnt UTSW 10 76,269,451 (GRCm39) missense probably benign 0.26
R5308:Pcnt UTSW 10 76,192,159 (GRCm39) nonsense probably null
R5328:Pcnt UTSW 10 76,247,553 (GRCm39) missense probably damaging 1.00
R5454:Pcnt UTSW 10 76,225,381 (GRCm39) splice site probably null
R5543:Pcnt UTSW 10 76,247,886 (GRCm39) missense probably benign 0.01
R5588:Pcnt UTSW 10 76,278,445 (GRCm39) missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76,221,675 (GRCm39) missense probably benign 0.17
R5668:Pcnt UTSW 10 76,245,334 (GRCm39) missense probably benign 0.16
R5712:Pcnt UTSW 10 76,265,105 (GRCm39) missense probably damaging 0.96
R5714:Pcnt UTSW 10 76,256,325 (GRCm39) missense probably damaging 1.00
R5797:Pcnt UTSW 10 76,228,590 (GRCm39) missense probably benign 0.00
R5946:Pcnt UTSW 10 76,217,897 (GRCm39) missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76,247,456 (GRCm39) missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76,255,871 (GRCm39) missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R6485:Pcnt UTSW 10 76,225,164 (GRCm39) nonsense probably null
R6605:Pcnt UTSW 10 76,265,032 (GRCm39) critical splice donor site probably null
R6877:Pcnt UTSW 10 76,269,851 (GRCm39) missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76,263,662 (GRCm39) missense probably benign 0.00
R6919:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R7025:Pcnt UTSW 10 76,239,669 (GRCm39) missense probably damaging 1.00
R7098:Pcnt UTSW 10 76,220,673 (GRCm39) missense probably benign
R7109:Pcnt UTSW 10 76,205,738 (GRCm39) missense probably damaging 1.00
R7121:Pcnt UTSW 10 76,263,761 (GRCm39) missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76,224,894 (GRCm39) missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76,247,194 (GRCm39) splice site probably null
R7213:Pcnt UTSW 10 76,244,738 (GRCm39) missense probably damaging 1.00
R7368:Pcnt UTSW 10 76,235,835 (GRCm39) missense probably benign
R7453:Pcnt UTSW 10 76,225,284 (GRCm39) missense probably benign
R7486:Pcnt UTSW 10 76,254,271 (GRCm39) missense probably benign
R7538:Pcnt UTSW 10 76,235,773 (GRCm39) missense probably benign
R7575:Pcnt UTSW 10 76,225,086 (GRCm39) missense probably benign 0.32
R7662:Pcnt UTSW 10 76,223,356 (GRCm39) missense probably benign 0.27
R7685:Pcnt UTSW 10 76,258,642 (GRCm39) missense probably benign 0.14
R7764:Pcnt UTSW 10 76,190,082 (GRCm39) missense probably benign 0.33
R7802:Pcnt UTSW 10 76,211,137 (GRCm39) splice site probably null
R8432:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8439:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8493:Pcnt UTSW 10 76,239,457 (GRCm39) critical splice donor site probably null
R8530:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8535:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8830:Pcnt UTSW 10 76,218,008 (GRCm39) missense probably benign 0.03
R8878:Pcnt UTSW 10 76,244,675 (GRCm39) missense probably damaging 1.00
R8911:Pcnt UTSW 10 76,223,359 (GRCm39) missense probably damaging 0.98
R8988:Pcnt UTSW 10 76,245,407 (GRCm39) nonsense probably null
R9084:Pcnt UTSW 10 76,235,826 (GRCm39) missense probably benign 0.09
R9169:Pcnt UTSW 10 76,221,572 (GRCm39) missense possibly damaging 0.95
R9372:Pcnt UTSW 10 76,258,960 (GRCm39) missense probably damaging 1.00
R9411:Pcnt UTSW 10 76,258,896 (GRCm39) missense probably damaging 0.96
R9448:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R9459:Pcnt UTSW 10 76,228,572 (GRCm39) missense probably damaging 1.00
R9479:Pcnt UTSW 10 76,217,963 (GRCm39) missense probably benign 0.00
R9503:Pcnt UTSW 10 76,263,882 (GRCm39) missense possibly damaging 0.59
R9561:Pcnt UTSW 10 76,217,128 (GRCm39) nonsense probably null
R9618:Pcnt UTSW 10 76,188,794 (GRCm39) missense probably damaging 1.00
R9648:Pcnt UTSW 10 76,190,089 (GRCm39) missense probably benign 0.32
R9733:Pcnt UTSW 10 76,237,314 (GRCm39) missense probably benign 0.01
Z1176:Pcnt UTSW 10 76,217,991 (GRCm39) nonsense probably null
Z1177:Pcnt UTSW 10 76,235,802 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAGAGGAGACCCTAGCAC -3'
(R):5'- GAATCTTGGCCACTTGCATG -3'

Sequencing Primer
(F):5'- AGAGGAGACCCTAGCACCCTTG -3'
(R):5'- ATACTCCTTGGGATGGGGAAATC -3'
Posted On 2019-10-07