Incidental Mutation 'R7486:Tcf20'
ID 580201
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Name transcription factor 20
Synonyms stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock # R7486 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 82808436-82987872 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82853734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1172 (M1172K)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000048966
AA Change: M1172K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: M1172K

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109510
AA Change: M1172K

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: M1172K

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cnnm2 T C 19: 46,762,074 V101A possibly damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
R9177:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9268:Tcf20 UTSW 15 82856504 missense probably benign 0.00
R9294:Tcf20 UTSW 15 82852696 missense probably benign 0.11
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACATTCCTGGAGGACCAC -3'
(R):5'- GGGACCCTAATACCGGTTTG -3'

Sequencing Primer
(F):5'- AGGACCACTGCTTTTGGC -3'
(R):5'- GGGACCCTAATACCGGTTTGAATTC -3'
Posted On 2019-10-07