Incidental Mutation 'R7486:Cnnm2'
ID580212
Institutional Source Beutler Lab
Gene Symbol Cnnm2
Ensembl Gene ENSMUSG00000064105
Gene Namecyclin M2
SynonymsAcdp2
Accession Numbers

Genbank: NM_033569; MGI: 2151054

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7486 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46761596-46878795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46762074 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000096972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077666] [ENSMUST00000099373]
Predicted Effect probably benign
Transcript: ENSMUST00000077666
AA Change: V101A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076850
Gene: ENSMUSG00000064105
AA Change: V101A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 7.8e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 7.6e-6 PFAM
Blast:cNMP 649 805 2e-49 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000099373
AA Change: V101A

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096972
Gene: ENSMUSG00000064105
AA Change: V101A

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
low complexity region 194 227 N/A INTRINSIC
Pfam:DUF21 257 431 2.6e-39 PFAM
Blast:CBS 455 505 3e-14 BLAST
Pfam:CBS 514 578 1.1e-5 PFAM
Blast:cNMP 649 827 1e-46 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain containing protein family. Members of this protein family contain a cyclin box motif and have structural similarity to the cyclins. The encoded protein may play an important role in magnesium homeostasis by mediating the epithelial transport and renal reabsorption of Mg2+. Mutations in this gene are associated with renal hypomagnesemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(90) : Gene trapped(90)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 T C 12: 81,558,883 I702V probably benign Het
Adgre5 T C 8: 83,723,886 E815G probably damaging Het
Adgrl2 A G 3: 148,817,694 V298A Het
Akp3 A G 1: 87,125,479 D91G probably damaging Het
Ano8 A G 8: 71,484,998 probably null Het
Blvra T C 2: 127,087,323 S136P unknown Het
Cacul1 T A 19: 60,580,430 M97L probably benign Het
Ccdc80 T C 16: 45,126,179 V827A probably damaging Het
Cep68 T C 11: 20,242,166 E11G probably benign Het
Cfap221 A T 1: 119,923,592 V813E possibly damaging Het
Chd6 A G 2: 160,950,003 V2478A probably damaging Het
Chmp6 T C 11: 119,916,957 F148S probably benign Het
Clca3a2 T A 3: 144,797,601 I863F probably damaging Het
Cpne8 A T 15: 90,515,906 probably null Het
Dmbt1 T G 7: 131,066,462 C483G unknown Het
Dnah7b G A 1: 46,290,734 G3246D probably damaging Het
Dnajc3 C A 14: 118,972,404 T297K probably benign Het
Dpm3 A G 3: 89,266,727 probably null Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erc1 G A 6: 119,594,946 Q1022* probably null Het
Ercc5 T A 1: 44,148,064 M1K probably null Het
Fam114a2 C T 11: 57,513,689 G83D probably damaging Het
Fat4 C A 3: 38,957,427 Y2225* probably null Het
Frk G A 10: 34,547,296 W123* probably null Het
Gm11568 T A 11: 99,858,466 C166S unknown Het
Gm12666 A T 4: 92,191,269 V105E probably benign Het
Gpr153 A G 4: 152,282,401 D337G probably benign Het
Gpt2 T C 8: 85,525,606 F517L probably damaging Het
Gsg1 C T 6: 135,237,429 E361K probably benign Het
Hsfy2 G A 1: 56,636,971 R136* probably null Het
Insm1 G A 2: 146,223,818 R518H probably damaging Het
Kank1 G A 19: 25,410,829 C622Y probably damaging Het
Katnb1 T A 8: 95,098,729 S640R probably damaging Het
Kcnmb4 A G 10: 116,418,275 V199A probably benign Het
Lamb1 T G 12: 31,287,442 S391A probably benign Het
Macf1 T G 4: 123,409,581 D376A probably benign Het
Map7d1 C A 4: 126,234,386 R614L unknown Het
Mcm8 C T 2: 132,839,520 R667W probably damaging Het
Med13l C T 5: 118,728,474 T531I probably benign Het
Mstn G T 1: 53,063,969 A155S probably damaging Het
Mycbp2 C T 14: 103,197,254 R2251K probably damaging Het
Myo19 T C 11: 84,905,637 S692P probably benign Het
Nipbl A T 15: 8,295,636 N2514K probably benign Het
Nkd2 T A 13: 73,847,442 probably benign Het
Nox3 T A 17: 3,669,944 Y322F probably damaging Het
Nt5dc1 A G 10: 34,399,809 Y135H probably benign Het
Olfr389 T C 11: 73,777,021 Y102C probably damaging Het
Olfr533 C T 7: 140,466,034 probably benign Het
Olfr979 T A 9: 40,000,885 Y114F probably benign Het
Oog3 T A 4: 144,158,172 H398L probably benign Het
Otogl A G 10: 107,821,988 L1027P probably damaging Het
Pcdh20 T A 14: 88,468,614 I417F possibly damaging Het
Pcdha12 T A 18: 37,021,557 V443E probably damaging Het
Pcdhga2 A G 18: 37,670,408 D435G probably benign Het
Pcnt G T 10: 76,418,436 T853K probably benign Het
Pcnt T C 10: 76,418,437 T853A probably benign Het
Pgghg T A 7: 140,942,480 S57R probably benign Het
Ppm1m T C 9: 106,196,611 D301G probably damaging Het
Ppp6r1 A G 7: 4,639,900 V519A probably benign Het
Prss41 ACAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCA 17: 23,844,098 probably benign Het
Rasa3 C T 8: 13,590,201 probably null Het
Robo4 T C 9: 37,405,574 V395A probably damaging Het
Scrib A G 15: 76,057,650 S1123P probably damaging Het
Setd1b A G 5: 123,163,592 K45E probably benign Het
Slc14a1 T C 18: 78,111,524 S216G probably benign Het
Slc25a45 A G 19: 5,884,969 Y282C probably damaging Het
Slc6a5 T C 7: 49,917,330 S255P possibly damaging Het
Smc2 A T 4: 52,462,861 Q617L possibly damaging Het
Spo11 G A 2: 172,984,077 D103N probably benign Het
Tcf20 A T 15: 82,853,734 M1172K possibly damaging Het
Tesc T A 5: 118,046,317 S21T probably benign Het
Tie1 C A 4: 118,479,904 probably null Het
Trim24 T G 6: 37,957,839 probably null Het
Trpm7 A G 2: 126,831,195 probably null Het
Unc13d T C 11: 116,074,433 D193G possibly damaging Het
Upk3a A T 15: 85,018,024 probably null Het
Vmn2r25 T C 6: 123,823,142 N747S probably damaging Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Zbtb2 G A 10: 4,369,025 Q334* probably null Het
Zfp653 T C 9: 22,056,528 N494D probably damaging Het
Zfp865 A G 7: 5,031,260 D748G possibly damaging Het
Zzef1 T C 11: 72,864,786 S1014P possibly damaging Het
Other mutations in Cnnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Cnnm2 APN 19 46763220 missense probably damaging 1.00
IGL01971:Cnnm2 APN 19 46871676 missense probably benign 0.19
IGL02003:Cnnm2 APN 19 46868559 missense probably damaging 1.00
IGL02068:Cnnm2 APN 19 46877388 missense possibly damaging 0.94
IGL02185:Cnnm2 APN 19 46762995 missense probably benign 0.45
IGL02652:Cnnm2 APN 19 46763211 missense probably damaging 1.00
IGL02682:Cnnm2 APN 19 46762076 missense probably benign 0.37
IGL03009:Cnnm2 APN 19 46877355 missense probably damaging 1.00
IGL03378:Cnnm2 APN 19 46878034 missense possibly damaging 0.76
R1581:Cnnm2 UTSW 19 46763123 missense probably damaging 0.99
R3700:Cnnm2 UTSW 19 46762551 missense probably damaging 1.00
R3892:Cnnm2 UTSW 19 46761793 nonsense probably null
R3911:Cnnm2 UTSW 19 46877936 missense probably damaging 0.96
R4508:Cnnm2 UTSW 19 46877270 missense probably benign 0.01
R4678:Cnnm2 UTSW 19 46763246 missense possibly damaging 0.91
R4878:Cnnm2 UTSW 19 46859083 missense probably benign 0.45
R5154:Cnnm2 UTSW 19 46763132 missense probably benign 0.02
R5445:Cnnm2 UTSW 19 46877288 missense possibly damaging 0.66
R5771:Cnnm2 UTSW 19 46856995 intron probably null
R5914:Cnnm2 UTSW 19 46763177 missense probably benign 0.07
R6263:Cnnm2 UTSW 19 46856905 missense probably benign 0.30
R6715:Cnnm2 UTSW 19 46853973 missense probably damaging 1.00
R6881:Cnnm2 UTSW 19 46877219 missense probably damaging 1.00
R7022:Cnnm2 UTSW 19 46762550 missense probably damaging 0.98
R7022:Cnnm2 UTSW 19 46858940 splice site probably null
R7600:Cnnm2 UTSW 19 46762067 missense probably benign 0.02
R7648:Cnnm2 UTSW 19 46877900 missense probably damaging 0.98
R7800:Cnnm2 UTSW 19 46877981 missense probably benign 0.28
X0017:Cnnm2 UTSW 19 46762463 missense probably benign 0.05
X0018:Cnnm2 UTSW 19 46762773 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCCCACTTGGAAGATGG -3'
(R):5'- CAAGATGATGATGTCTGAGGTGCG -3'

Sequencing Primer
(F):5'- CACTTGGAAGATGGCGGCG -3'
(R):5'- TCTGAGGTGCGGATGCC -3'
Posted On2019-10-07