Incidental Mutation 'R0631:Nedd4l'
ID 58023
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Name neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms Nedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 038820-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R0631 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 65020776-65350899 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 65341574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080418
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163516
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably benign
Transcript: ENSMUST00000226058
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 97% (129/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 131 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadat T C 8: 60,982,479 (GRCm39) probably benign Het
Afap1l2 T C 19: 56,904,517 (GRCm39) E594G probably benign Het
Ak8 T G 2: 28,625,677 (GRCm39) I240S probably damaging Het
Akap13 T C 7: 75,264,744 (GRCm39) V174A probably damaging Het
Alppl2 G A 1: 87,017,095 (GRCm39) T66I probably damaging Het
Ankrd61 T A 5: 143,831,697 (GRCm39) I36F probably damaging Het
Antxrl T A 14: 33,780,758 (GRCm39) probably null Het
Arhgef2 G C 3: 88,541,743 (GRCm39) V244L probably damaging Het
Arid1a A G 4: 133,416,481 (GRCm39) I1098T unknown Het
Atr T C 9: 95,756,830 (GRCm39) V903A possibly damaging Het
B3gnt6 C A 7: 97,842,899 (GRCm39) A354S probably benign Het
Bnc1 A T 7: 81,624,114 (GRCm39) I371N probably damaging Het
Camsap1 A T 2: 25,823,659 (GRCm39) S1464T probably damaging Het
Cand2 G A 6: 115,780,766 (GRCm39) E1217K probably damaging Het
Cass4 T C 2: 172,274,331 (GRCm39) I728T probably damaging Het
Ccdc88a A T 11: 29,443,752 (GRCm39) M1378L probably damaging Het
Ccdc9 C A 7: 16,012,384 (GRCm39) W266L probably damaging Het
Cct6b C A 11: 82,627,914 (GRCm39) probably null Het
Cd177 T C 7: 24,456,111 (GRCm39) E219G probably benign Het
Cdkal1 A T 13: 29,538,667 (GRCm39) Y497* probably null Het
Chmp2a T C 7: 12,766,371 (GRCm39) E107G probably damaging Het
Chrna2 T G 14: 66,386,757 (GRCm39) V301G probably benign Het
Chrna7 A G 7: 62,749,391 (GRCm39) C364R probably benign Het
Cltc G T 11: 86,603,439 (GRCm39) L796I probably benign Het
Col12a1 T C 9: 79,610,658 (GRCm39) T249A probably damaging Het
Col13a1 G A 10: 61,723,129 (GRCm39) Q270* probably null Het
Col6a1 C T 10: 76,545,569 (GRCm39) V968M probably benign Het
Copb1 C A 7: 113,832,517 (GRCm39) V511F probably benign Het
Daw1 C G 1: 83,174,981 (GRCm39) S160R probably damaging Het
Ddx46 A G 13: 55,787,590 (GRCm39) probably benign Het
Depdc7 T C 2: 104,552,332 (GRCm39) K492E possibly damaging Het
Dmbt1 C T 7: 130,699,383 (GRCm39) A1004V possibly damaging Het
Dnah7b G A 1: 46,280,152 (GRCm39) V2694I probably benign Het
Dnhd1 T A 7: 105,300,831 (GRCm39) F63I probably benign Het
Edc4 C A 8: 106,617,424 (GRCm39) A1052E possibly damaging Het
Eif2s2 T A 2: 154,726,278 (GRCm39) K129M probably damaging Het
Emx2 A G 19: 59,452,460 (GRCm39) D248G probably damaging Het
Erich6b T C 14: 75,896,449 (GRCm39) probably benign Het
Exoc3l4 A G 12: 111,394,400 (GRCm39) K507E probably benign Het
Fanci T A 7: 79,055,953 (GRCm39) V195E probably damaging Het
Fgfr2 T G 7: 129,828,969 (GRCm39) probably benign Het
Frem1 A G 4: 82,890,402 (GRCm39) S1007P probably damaging Het
Fry T C 5: 150,419,817 (GRCm39) I993T possibly damaging Het
Fst A G 13: 114,591,038 (GRCm39) S244P possibly damaging Het
Gcc1 T C 6: 28,421,009 (GRCm39) T103A probably damaging Het
Gdf2 C T 14: 33,663,178 (GRCm39) P24L probably damaging Het
Gja3 T C 14: 57,274,219 (GRCm39) D51G possibly damaging Het
Gm10305 A G 4: 99,161,313 (GRCm39) D74G unknown Het
Gm12689 G T 4: 99,184,258 (GRCm39) G37V unknown Het
Gm5424 C T 10: 61,907,313 (GRCm39) noncoding transcript Het
Hephl1 T C 9: 14,995,820 (GRCm39) E434G probably benign Het
Hoatz T A 9: 51,013,253 (GRCm39) R6S probably benign Het
Htatip2 T C 7: 49,423,059 (GRCm39) C205R possibly damaging Het
Igf2r T C 17: 12,936,161 (GRCm39) probably null Het
Ints2 T C 11: 86,124,022 (GRCm39) I589V probably benign Het
Itgae T A 11: 73,005,733 (GRCm39) V299D probably damaging Het
Kcnma1 T C 14: 23,559,852 (GRCm39) probably benign Het
Kif11 A G 19: 37,401,565 (GRCm39) probably benign Het
Kif13a A G 13: 46,932,364 (GRCm39) probably benign Het
Kif18a T A 2: 109,128,667 (GRCm39) probably benign Het
Klhl29 T C 12: 5,144,883 (GRCm39) T406A probably benign Het
Litaf A T 16: 10,784,276 (GRCm39) probably benign Het
Lmntd1 T A 6: 145,375,726 (GRCm39) I71F probably benign Het
Lrit3 A C 3: 129,582,204 (GRCm39) C594W probably damaging Het
Lrp6 T A 6: 134,456,738 (GRCm39) Q842L possibly damaging Het
Lrrcc1 T A 3: 14,605,179 (GRCm39) probably benign Het
Macf1 A T 4: 123,349,317 (GRCm39) L1829* probably null Het
Mapk1ip1 T C 7: 138,437,684 (GRCm39) T249A possibly damaging Het
Mfap4 T C 11: 61,378,006 (GRCm39) F173L probably damaging Het
Mfsd9 C A 1: 40,829,634 (GRCm39) probably benign Het
Mgat4b T C 11: 50,121,590 (GRCm39) S69P probably damaging Het
Mki67 A T 7: 135,306,117 (GRCm39) V620D probably damaging Het
Moxd1 C T 10: 24,128,852 (GRCm39) T201I probably damaging Het
Msh4 G C 3: 153,572,057 (GRCm39) D774E probably benign Het
Myg1 C T 15: 102,240,284 (GRCm39) R37C probably benign Het
Myrf C A 19: 10,206,246 (GRCm39) A57S probably benign Het
Ndst1 G A 18: 60,833,431 (GRCm39) probably benign Het
Neil2 T A 14: 63,420,849 (GRCm39) I281F possibly damaging Het
Nfatc2 T A 2: 168,432,035 (GRCm39) D26V probably benign Het
Nt5c A G 11: 115,381,540 (GRCm39) probably null Het
Or13a24 T G 7: 140,154,420 (GRCm39) M118R probably damaging Het
Or2w1b G T 13: 21,300,078 (GRCm39) C72F probably damaging Het
Or2z8 T A 8: 72,812,166 (GRCm39) I214N probably damaging Het
Or5ac20 A G 16: 59,104,570 (GRCm39) C97R possibly damaging Het
Or5t15 T C 2: 86,681,311 (GRCm39) T244A probably benign Het
Ovch2 A G 7: 107,381,228 (GRCm39) S557P probably benign Het
Pik3cg A G 12: 32,255,202 (GRCm39) S262P probably benign Het
Pla2g6 T A 15: 79,190,596 (GRCm39) H322L probably damaging Het
Plch1 A T 3: 63,606,640 (GRCm39) L1079Q probably benign Het
Plekhg4 T A 8: 106,105,934 (GRCm39) V777D probably damaging Het
Plekhg5 A G 4: 152,196,876 (GRCm39) D747G possibly damaging Het
Poln C A 5: 34,276,302 (GRCm39) V318F possibly damaging Het
Pou5f2 T A 13: 78,173,873 (GRCm39) S272T probably benign Het
Ppp1r3e T G 14: 55,114,073 (GRCm39) S200R possibly damaging Het
Prl7d1 G A 13: 27,894,165 (GRCm39) P135S probably benign Het
Ptgs2 G A 1: 149,980,288 (GRCm39) V409I probably benign Het
Ptk2b T C 14: 66,415,200 (GRCm39) T276A probably damaging Het
Ptpn3 T C 4: 57,204,921 (GRCm39) T747A probably damaging Het
Qrfpr A G 3: 36,276,138 (GRCm39) I84T probably damaging Het
Rab44 A G 17: 29,358,118 (GRCm39) D102G possibly damaging Het
Rimoc1 A G 15: 4,015,971 (GRCm39) probably benign Het
Rnf125 A T 18: 21,112,140 (GRCm39) D57V possibly damaging Het
Rnf145 T C 11: 44,450,851 (GRCm39) F392L probably damaging Het
Rttn A G 18: 89,007,670 (GRCm39) N435S probably benign Het
Scn8a A G 15: 100,933,418 (GRCm39) T1500A probably damaging Het
Sgsm1 A G 5: 113,432,989 (GRCm39) probably benign Het
Sgsm3 A T 15: 80,895,937 (GRCm39) *751C probably null Het
Slc35c2 A C 2: 165,122,849 (GRCm39) L145R probably damaging Het
Slc4a7 A T 14: 14,757,382 (GRCm38) E396V probably damaging Het
Smarca4 G C 9: 21,570,280 (GRCm39) probably benign Het
Snapc3 T A 4: 83,336,039 (GRCm39) V17D probably damaging Het
Snta1 G T 2: 154,218,992 (GRCm39) Q448K probably benign Het
Sptbn2 A G 19: 4,790,014 (GRCm39) D1334G probably benign Het
Stard5 A G 7: 83,281,965 (GRCm39) R41G probably damaging Het
Stxbp5 T A 10: 9,660,102 (GRCm39) N731I probably benign Het
Tmem135 T A 7: 88,792,996 (GRCm39) K413* probably null Het
Tmem38a G A 8: 73,333,862 (GRCm39) V114I probably benign Het
Tpr A G 1: 150,298,282 (GRCm39) T1057A probably damaging Het
Ttc23l A T 15: 10,540,066 (GRCm39) L139Q probably damaging Het
Ttn T A 2: 76,585,640 (GRCm39) probably null Het
Tuba3b A G 6: 145,565,302 (GRCm39) T257A probably damaging Het
Tubgcp6 A C 15: 88,985,190 (GRCm39) Y1633D probably damaging Het
Txnl1 C T 18: 63,804,644 (GRCm39) probably benign Het
Unc13b A G 4: 43,182,849 (GRCm39) Q3186R possibly damaging Het
Vmn2r75 T A 7: 85,812,478 (GRCm39) S514C probably null Het
Whrn G A 4: 63,337,726 (GRCm39) T545I probably damaging Het
Zdhhc20 T C 14: 58,095,097 (GRCm39) H154R probably damaging Het
Zfp462 A T 4: 55,007,563 (GRCm39) M1L possibly damaging Het
Zfp831 A G 2: 174,487,083 (GRCm39) K586R possibly damaging Het
Zfp990 A T 4: 145,263,872 (GRCm39) H290L possibly damaging Het
Zfpm1 C T 8: 123,063,613 (GRCm39) probably benign Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65,341,163 (GRCm39) missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65,305,470 (GRCm39) missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65,306,025 (GRCm39) missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65,341,116 (GRCm39) splice site probably benign
IGL02440:Nedd4l APN 18 65,296,244 (GRCm39) critical splice donor site probably null
IGL02444:Nedd4l APN 18 65,337,028 (GRCm39) splice site probably benign
IGL02700:Nedd4l APN 18 65,342,751 (GRCm39) missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65,294,723 (GRCm39) critical splice donor site probably null
IGL02999:Nedd4l APN 18 65,331,778 (GRCm39) missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65,338,741 (GRCm39) missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65,314,391 (GRCm39) splice site probably benign
R0036:Nedd4l UTSW 18 65,184,194 (GRCm39) intron probably benign
R0396:Nedd4l UTSW 18 65,294,725 (GRCm39) splice site probably benign
R0472:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65,306,092 (GRCm39) missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65,328,256 (GRCm39) splice site probably benign
R0609:Nedd4l UTSW 18 65,341,532 (GRCm39) missense probably damaging 1.00
R1077:Nedd4l UTSW 18 65,300,570 (GRCm39) splice site probably benign
R1643:Nedd4l UTSW 18 65,331,712 (GRCm39) missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65,291,010 (GRCm39) missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65,345,862 (GRCm39) missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65,300,646 (GRCm39) critical splice donor site probably null
R1986:Nedd4l UTSW 18 65,276,874 (GRCm39) missense probably damaging 1.00
R2070:Nedd4l UTSW 18 65,345,891 (GRCm39) missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65,343,401 (GRCm39) missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65,296,201 (GRCm39) missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65,312,049 (GRCm39) missense probably benign 0.00
R3500:Nedd4l UTSW 18 65,345,931 (GRCm39) missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65,342,790 (GRCm39) missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65,300,606 (GRCm39) missense probably benign
R4435:Nedd4l UTSW 18 65,345,896 (GRCm39) missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65,336,951 (GRCm39) missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65,298,676 (GRCm39) missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65,305,998 (GRCm39) missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65,337,016 (GRCm39) missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65,213,131 (GRCm39) nonsense probably null
R5106:Nedd4l UTSW 18 65,326,376 (GRCm39) missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65,324,518 (GRCm39) missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65,307,315 (GRCm39) critical splice donor site probably null
R6465:Nedd4l UTSW 18 65,288,335 (GRCm39) missense probably benign 0.06
R6479:Nedd4l UTSW 18 65,342,752 (GRCm39) missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65,307,305 (GRCm39) missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65,300,622 (GRCm39) missense probably benign 0.36
R7065:Nedd4l UTSW 18 65,329,040 (GRCm39) missense probably benign 0.04
R7068:Nedd4l UTSW 18 65,338,722 (GRCm39) missense probably damaging 1.00
R7193:Nedd4l UTSW 18 65,130,441 (GRCm39) missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65,213,089 (GRCm39) missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65,319,438 (GRCm39) missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65,207,845 (GRCm39) missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65,342,769 (GRCm39) missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65,324,560 (GRCm39) missense probably damaging 0.98
R8440:Nedd4l UTSW 18 65,022,126 (GRCm39) splice site probably null
R8499:Nedd4l UTSW 18 65,342,728 (GRCm39) missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65,336,986 (GRCm39) missense probably benign 0.00
R8801:Nedd4l UTSW 18 65,288,346 (GRCm39) missense probably damaging 1.00
R8896:Nedd4l UTSW 18 65,298,688 (GRCm39) missense probably benign
R9025:Nedd4l UTSW 18 65,311,995 (GRCm39) missense probably damaging 0.98
R9040:Nedd4l UTSW 18 65,342,734 (GRCm39) missense probably damaging 0.99
R9482:Nedd4l UTSW 18 65,021,031 (GRCm39) unclassified probably benign
R9498:Nedd4l UTSW 18 65,294,723 (GRCm39) critical splice donor site probably null
R9599:Nedd4l UTSW 18 65,343,400 (GRCm39) missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65,342,751 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCTCAACCTGCATGTCCCAC -3'
(R):5'- TTTTCTGAGCCCAACAGACTAGAAACC -3'

Sequencing Primer
(F):5'- TGCATGTCCCACACCGC -3'
(R):5'- TCACACAGAGCTCAGGACT -3'
Posted On 2013-07-11